ID: 984512414

View in Genome Browser
Species Human (GRCh38)
Location 4:180694501-180694523
Sequence GGTAAGAGGGAGCCAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512414_984512424 23 Left 984512414 4:180694501-180694523 CCATCCATTGGCTCCCTCTTACC No data
Right 984512424 4:180694547-180694569 AACTCAATATGAGATTTGTGTGG No data
984512414_984512426 25 Left 984512414 4:180694501-180694523 CCATCCATTGGCTCCCTCTTACC No data
Right 984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG No data
984512414_984512422 -6 Left 984512414 4:180694501-180694523 CCATCCATTGGCTCCCTCTTACC No data
Right 984512422 4:180694518-180694540 CTTACCACATGTGGGGATTTGGG No data
984512414_984512425 24 Left 984512414 4:180694501-180694523 CCATCCATTGGCTCCCTCTTACC No data
Right 984512425 4:180694548-180694570 ACTCAATATGAGATTTGTGTGGG No data
984512414_984512421 -7 Left 984512414 4:180694501-180694523 CCATCCATTGGCTCCCTCTTACC No data
Right 984512421 4:180694517-180694539 TCTTACCACATGTGGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512414 Original CRISPR GGTAAGAGGGAGCCAATGGA TGG (reversed) Intergenic