ID: 984512415

View in Genome Browser
Species Human (GRCh38)
Location 4:180694505-180694527
Sequence ATGTGGTAAGAGGGAGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512415_984512425 20 Left 984512415 4:180694505-180694527 CCATTGGCTCCCTCTTACCACAT No data
Right 984512425 4:180694548-180694570 ACTCAATATGAGATTTGTGTGGG No data
984512415_984512426 21 Left 984512415 4:180694505-180694527 CCATTGGCTCCCTCTTACCACAT No data
Right 984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG No data
984512415_984512424 19 Left 984512415 4:180694505-180694527 CCATTGGCTCCCTCTTACCACAT No data
Right 984512424 4:180694547-180694569 AACTCAATATGAGATTTGTGTGG No data
984512415_984512422 -10 Left 984512415 4:180694505-180694527 CCATTGGCTCCCTCTTACCACAT No data
Right 984512422 4:180694518-180694540 CTTACCACATGTGGGGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512415 Original CRISPR ATGTGGTAAGAGGGAGCCAA TGG (reversed) Intergenic
No off target data available for this crispr