ID: 984512416

View in Genome Browser
Species Human (GRCh38)
Location 4:180694509-180694531
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512411_984512416 0 Left 984512411 4:180694486-180694508 CCCATGATTCAATTACCATCCAT No data
Right 984512416 4:180694509-180694531 TGGCTCCCTCTTACCACATGTGG No data
984512410_984512416 1 Left 984512410 4:180694485-180694507 CCCCATGATTCAATTACCATCCA No data
Right 984512416 4:180694509-180694531 TGGCTCCCTCTTACCACATGTGG No data
984512412_984512416 -1 Left 984512412 4:180694487-180694509 CCATGATTCAATTACCATCCATT No data
Right 984512416 4:180694509-180694531 TGGCTCCCTCTTACCACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type