ID: 984512417

View in Genome Browser
Species Human (GRCh38)
Location 4:180694510-180694532
Sequence GGCTCCCTCTTACCACATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512411_984512417 1 Left 984512411 4:180694486-180694508 CCCATGATTCAATTACCATCCAT No data
Right 984512417 4:180694510-180694532 GGCTCCCTCTTACCACATGTGGG No data
984512412_984512417 0 Left 984512412 4:180694487-180694509 CCATGATTCAATTACCATCCATT No data
Right 984512417 4:180694510-180694532 GGCTCCCTCTTACCACATGTGGG No data
984512410_984512417 2 Left 984512410 4:180694485-180694507 CCCCATGATTCAATTACCATCCA No data
Right 984512417 4:180694510-180694532 GGCTCCCTCTTACCACATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512417 Original CRISPR GGCTCCCTCTTACCACATGT GGG Intergenic
No off target data available for this crispr