ID: 984512419

View in Genome Browser
Species Human (GRCh38)
Location 4:180694514-180694536
Sequence AATCCCCACATGTGGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512419_984512426 12 Left 984512419 4:180694514-180694536 CCCTCTTACCACATGTGGGGATT No data
Right 984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG No data
984512419_984512424 10 Left 984512419 4:180694514-180694536 CCCTCTTACCACATGTGGGGATT No data
Right 984512424 4:180694547-180694569 AACTCAATATGAGATTTGTGTGG No data
984512419_984512425 11 Left 984512419 4:180694514-180694536 CCCTCTTACCACATGTGGGGATT No data
Right 984512425 4:180694548-180694570 ACTCAATATGAGATTTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512419 Original CRISPR AATCCCCACATGTGGTAAGA GGG (reversed) Intergenic