ID: 984512420

View in Genome Browser
Species Human (GRCh38)
Location 4:180694515-180694537
Sequence AAATCCCCACATGTGGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512420_984512426 11 Left 984512420 4:180694515-180694537 CCTCTTACCACATGTGGGGATTT No data
Right 984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG No data
984512420_984512424 9 Left 984512420 4:180694515-180694537 CCTCTTACCACATGTGGGGATTT No data
Right 984512424 4:180694547-180694569 AACTCAATATGAGATTTGTGTGG No data
984512420_984512425 10 Left 984512420 4:180694515-180694537 CCTCTTACCACATGTGGGGATTT No data
Right 984512425 4:180694548-180694570 ACTCAATATGAGATTTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512420 Original CRISPR AAATCCCCACATGTGGTAAG AGG (reversed) Intergenic
No off target data available for this crispr