ID: 984512421

View in Genome Browser
Species Human (GRCh38)
Location 4:180694517-180694539
Sequence TCTTACCACATGTGGGGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512411_984512421 8 Left 984512411 4:180694486-180694508 CCCATGATTCAATTACCATCCAT No data
Right 984512421 4:180694517-180694539 TCTTACCACATGTGGGGATTTGG No data
984512414_984512421 -7 Left 984512414 4:180694501-180694523 CCATCCATTGGCTCCCTCTTACC No data
Right 984512421 4:180694517-180694539 TCTTACCACATGTGGGGATTTGG No data
984512410_984512421 9 Left 984512410 4:180694485-180694507 CCCCATGATTCAATTACCATCCA No data
Right 984512421 4:180694517-180694539 TCTTACCACATGTGGGGATTTGG No data
984512412_984512421 7 Left 984512412 4:180694487-180694509 CCATGATTCAATTACCATCCATT No data
Right 984512421 4:180694517-180694539 TCTTACCACATGTGGGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512421 Original CRISPR TCTTACCACATGTGGGGATT TGG Intergenic
No off target data available for this crispr