ID: 984512422

View in Genome Browser
Species Human (GRCh38)
Location 4:180694518-180694540
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512414_984512422 -6 Left 984512414 4:180694501-180694523 CCATCCATTGGCTCCCTCTTACC No data
Right 984512422 4:180694518-180694540 CTTACCACATGTGGGGATTTGGG No data
984512415_984512422 -10 Left 984512415 4:180694505-180694527 CCATTGGCTCCCTCTTACCACAT No data
Right 984512422 4:180694518-180694540 CTTACCACATGTGGGGATTTGGG No data
984512412_984512422 8 Left 984512412 4:180694487-180694509 CCATGATTCAATTACCATCCATT No data
Right 984512422 4:180694518-180694540 CTTACCACATGTGGGGATTTGGG No data
984512411_984512422 9 Left 984512411 4:180694486-180694508 CCCATGATTCAATTACCATCCAT No data
Right 984512422 4:180694518-180694540 CTTACCACATGTGGGGATTTGGG No data
984512410_984512422 10 Left 984512410 4:180694485-180694507 CCCCATGATTCAATTACCATCCA No data
Right 984512422 4:180694518-180694540 CTTACCACATGTGGGGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type