ID: 984512423

View in Genome Browser
Species Human (GRCh38)
Location 4:180694522-180694544
Sequence AGTTCCCAAATCCCCACATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512423_984512427 25 Left 984512423 4:180694522-180694544 CCACATGTGGGGATTTGGGAACT No data
Right 984512427 4:180694570-180694592 GGACACAGCCAAACTGTATCAGG 0: 16
1: 69
2: 569
3: 581
4: 564
984512423_984512424 2 Left 984512423 4:180694522-180694544 CCACATGTGGGGATTTGGGAACT No data
Right 984512424 4:180694547-180694569 AACTCAATATGAGATTTGTGTGG No data
984512423_984512425 3 Left 984512423 4:180694522-180694544 CCACATGTGGGGATTTGGGAACT No data
Right 984512425 4:180694548-180694570 ACTCAATATGAGATTTGTGTGGG No data
984512423_984512426 4 Left 984512423 4:180694522-180694544 CCACATGTGGGGATTTGGGAACT No data
Right 984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512423 Original CRISPR AGTTCCCAAATCCCCACATG TGG (reversed) Intergenic
No off target data available for this crispr