ID: 984512424

View in Genome Browser
Species Human (GRCh38)
Location 4:180694547-180694569
Sequence AACTCAATATGAGATTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512415_984512424 19 Left 984512415 4:180694505-180694527 CCATTGGCTCCCTCTTACCACAT No data
Right 984512424 4:180694547-180694569 AACTCAATATGAGATTTGTGTGG No data
984512414_984512424 23 Left 984512414 4:180694501-180694523 CCATCCATTGGCTCCCTCTTACC No data
Right 984512424 4:180694547-180694569 AACTCAATATGAGATTTGTGTGG No data
984512423_984512424 2 Left 984512423 4:180694522-180694544 CCACATGTGGGGATTTGGGAACT No data
Right 984512424 4:180694547-180694569 AACTCAATATGAGATTTGTGTGG No data
984512419_984512424 10 Left 984512419 4:180694514-180694536 CCCTCTTACCACATGTGGGGATT No data
Right 984512424 4:180694547-180694569 AACTCAATATGAGATTTGTGTGG No data
984512420_984512424 9 Left 984512420 4:180694515-180694537 CCTCTTACCACATGTGGGGATTT No data
Right 984512424 4:180694547-180694569 AACTCAATATGAGATTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512424 Original CRISPR AACTCAATATGAGATTTGTG TGG Intergenic
No off target data available for this crispr