ID: 984512425

View in Genome Browser
Species Human (GRCh38)
Location 4:180694548-180694570
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512414_984512425 24 Left 984512414 4:180694501-180694523 CCATCCATTGGCTCCCTCTTACC No data
Right 984512425 4:180694548-180694570 ACTCAATATGAGATTTGTGTGGG No data
984512415_984512425 20 Left 984512415 4:180694505-180694527 CCATTGGCTCCCTCTTACCACAT No data
Right 984512425 4:180694548-180694570 ACTCAATATGAGATTTGTGTGGG No data
984512420_984512425 10 Left 984512420 4:180694515-180694537 CCTCTTACCACATGTGGGGATTT No data
Right 984512425 4:180694548-180694570 ACTCAATATGAGATTTGTGTGGG No data
984512423_984512425 3 Left 984512423 4:180694522-180694544 CCACATGTGGGGATTTGGGAACT No data
Right 984512425 4:180694548-180694570 ACTCAATATGAGATTTGTGTGGG No data
984512419_984512425 11 Left 984512419 4:180694514-180694536 CCCTCTTACCACATGTGGGGATT No data
Right 984512425 4:180694548-180694570 ACTCAATATGAGATTTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type