ID: 984512426

View in Genome Browser
Species Human (GRCh38)
Location 4:180694549-180694571
Sequence CTCAATATGAGATTTGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512415_984512426 21 Left 984512415 4:180694505-180694527 CCATTGGCTCCCTCTTACCACAT No data
Right 984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG No data
984512419_984512426 12 Left 984512419 4:180694514-180694536 CCCTCTTACCACATGTGGGGATT No data
Right 984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG No data
984512423_984512426 4 Left 984512423 4:180694522-180694544 CCACATGTGGGGATTTGGGAACT No data
Right 984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG No data
984512414_984512426 25 Left 984512414 4:180694501-180694523 CCATCCATTGGCTCCCTCTTACC No data
Right 984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG No data
984512420_984512426 11 Left 984512420 4:180694515-180694537 CCTCTTACCACATGTGGGGATTT No data
Right 984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512426 Original CRISPR CTCAATATGAGATTTGTGTG GGG Intergenic
No off target data available for this crispr