ID: 984512427

View in Genome Browser
Species Human (GRCh38)
Location 4:180694570-180694592
Sequence GGACACAGCCAAACTGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1799
Summary {0: 16, 1: 69, 2: 569, 3: 581, 4: 564}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512423_984512427 25 Left 984512423 4:180694522-180694544 CCACATGTGGGGATTTGGGAACT No data
Right 984512427 4:180694570-180694592 GGACACAGCCAAACTGTATCAGG 0: 16
1: 69
2: 569
3: 581
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512427 Original CRISPR GGACACAGCCAAACTGTATC AGG Intergenic
900080934 1:856848-856870 GGCCACAGCCACACTGTAAGGGG + Intergenic
900239735 1:1610180-1610202 GGACACAGCCAAACTGTATCAGG - Intergenic
900681328 1:3918341-3918363 GGACACAGCCAAACTATATCGGG - Intergenic
900735476 1:4297050-4297072 GGACACAGCCAAACCACATCAGG + Intergenic
900742365 1:4338473-4338495 AGACACAGCCAAACCATATGAGG - Intergenic
900821011 1:4888610-4888632 GGACACAGCCAAACTATATCAGG + Intergenic
900825130 1:4920295-4920317 GGACACAGCCAAACCATATCAGG + Intergenic
900865158 1:5263529-5263551 GGACACAGCCAAATCATATCAGG - Intergenic
900877120 1:5350728-5350750 GGACACGGCCAAACCATATCAGG - Intergenic
900908790 1:5579568-5579590 GTGCACAGCCAAACCATATCAGG + Intergenic
900935412 1:5763428-5763450 GGACACAGCTGAACCGTATCAGG - Intergenic
900955881 1:5886225-5886247 GGACACAGCAAAACTCAATTAGG - Intronic
901243876 1:7713044-7713066 AAACACAGCCAAACCATATCAGG + Intronic
901397689 1:8993331-8993353 GGACACAGCCTAAACATATCAGG + Intergenic
901468697 1:9440721-9440743 GGACACATTCAAACCGTAGCAGG + Intergenic
901808832 1:11754351-11754373 GGACACAGCCAAACCATATCAGG + Intronic
901886129 1:12224485-12224507 GGACACAGCCAAACCACATCAGG + Intergenic
902065446 1:13681858-13681880 GGACACAGCCAAACTATCTCAGG + Intergenic
902084633 1:13849435-13849457 GGACACAGCCAGACCATATCAGG - Intergenic
902115172 1:14115304-14115326 GGGCACAGCCAAACCATATCAGG - Intergenic
902643706 1:17783170-17783192 GGACACAGCCAAACCATATCAGG - Intronic
902643965 1:17785153-17785175 GGACACAGCCAAACCATATCAGG + Intronic
902672894 1:17987268-17987290 GGACACAGCCAAACCATATCAGG + Intergenic
902703284 1:18187659-18187681 GGACACAGCCAAACCATATCAGG + Intronic
902760796 1:18579619-18579641 GGACACAGCCAAACCATATCAGG + Intergenic
903380099 1:22890618-22890640 GGACACAGCCAAACCATATCAGG - Intronic
904453312 1:30630822-30630844 GGTCACAGCCAAACCACATCAGG - Intergenic
904579231 1:31528128-31528150 GGACACAGCCAAACCATATCCGG + Intergenic
905948184 1:41921262-41921284 GGACACAGCCAAACCATATCAGG - Intronic
906833350 1:49058204-49058226 GGACACAGCCAAACCATATCAGG - Intronic
906856192 1:49307883-49307905 ACACAAATCCAAACTGTATCAGG - Intronic
906857243 1:49321079-49321101 GGACACAGCTAAACCATACCAGG + Intronic
907265588 1:53258342-53258364 GGACCCAGCCACATTGTGTCAGG + Exonic
907395350 1:54185794-54185816 GGACACAGCCAAACCATATCAGG - Intronic
907508671 1:54942155-54942177 GGACACAGCCCAACCATATCAGG - Intergenic
907555338 1:55338506-55338528 GGTCACAGCCAAACCATATCAGG - Intergenic
907582648 1:55585738-55585760 GAACACAGCCAAACTATATCAGG + Intergenic
907586094 1:55619419-55619441 GGACACAGCCAAACCATATCAGG - Intergenic
908006753 1:59735924-59735946 GGACACAGCCAAACCATATCAGG - Intronic
908020152 1:59890633-59890655 GGACACAGCCAAACCATATCAGG + Intergenic
908085898 1:60633376-60633398 GGACACAGCCAAATCATATCAGG + Intergenic
908223515 1:62033090-62033112 GGACACAGCCAAACCATATCAGG + Intronic
908399152 1:63754000-63754022 GGACACAGCCAAACCATATCAGG + Intergenic
908485097 1:64583948-64583970 GGACACAGCCAAACCATATTAGG + Intronic
908549814 1:65197145-65197167 GGACACAGCCAAACCACATCAGG + Intronic
908579520 1:65499911-65499933 GGACACAGCCCAACTAGGTCAGG - Intronic
908603450 1:65766041-65766063 GGGCACAGCCAAACCATATTAGG + Intergenic
908936713 1:69384770-69384792 GGACACAGGTAAACCATATCAGG + Intergenic
909293490 1:73913588-73913610 GGAGACAGCCAAACCATATCAGG + Intergenic
909468566 1:76001459-76001481 GGACACAGCCAAACCATATCAGG - Intergenic
909887714 1:80963196-80963218 GGACACAGCCAGACCGTATCAGG + Intergenic
909910889 1:81256388-81256410 GGACACAGCCAAACCACATCAGG + Intergenic
909992352 1:82239386-82239408 GGACACAGGCAAACAGGGTCTGG - Intergenic
910256284 1:85250238-85250260 GGACACAGCCAAACCAGATCAGG + Intronic
910278214 1:85470485-85470507 GGACAGAACCAAACCATATCAGG + Intronic
910336524 1:86138391-86138413 GGACACAGCCAAACCATATCAGG - Intronic
910538222 1:88324113-88324135 GGACACAGCCAAACCATGTCAGG + Intergenic
910628728 1:89335947-89335969 GGACACAGCCAAACCATATCAGG - Intergenic
910715384 1:90224435-90224457 GCACACAGCCAAACCATATAAGG - Intergenic
910740463 1:90510177-90510199 GGGCACAGCCAAACCATATCAGG - Intergenic
911200118 1:95036140-95036162 GGACACAACCAAACTATATCAGG - Intronic
911211465 1:95142932-95142954 GGACACAGCAAGACTCCATCTGG + Intronic
911236520 1:95418087-95418109 GGACACAGCCAAACCATGTTAGG + Intergenic
911274792 1:95848370-95848392 GGATACAGCCAAACCATATCAGG - Intergenic
911305833 1:96231121-96231143 GGACACAGCCAAACCATATCAGG + Intergenic
911736537 1:101342861-101342883 GGACACAGCGAAACTATATCAGG - Intergenic
911933660 1:103938069-103938091 AGACAGATCCAAACTATATCAGG - Intergenic
912095678 1:106140078-106140100 GGACACAGTCAAACTATATCTGG - Intergenic
912479962 1:109975452-109975474 TGACAGAGCAAAACTGTCTCAGG + Intergenic
912712462 1:111959808-111959830 GGACACGGCCAAACCATATCAGG - Intronic
913286888 1:117234664-117234686 GGACACAGCCAAACTATATCAGG + Intergenic
913396507 1:118377735-118377757 GGACACAGCCAAACCACATCAGG + Intergenic
913489359 1:119364491-119364513 GGACACAGCTAAACCATATTAGG + Intergenic
915210939 1:154308839-154308861 CGACACAGTCAAACCATATCAGG - Intergenic
915379513 1:155427739-155427761 GCGCACATCCAAACTGTATCAGG - Intronic
915695649 1:157739156-157739178 GGACACAGCCAAACCATATCAGG + Intergenic
915766328 1:158366109-158366131 GGACACAGCCAAGCCGTATCAGG - Intergenic
915900647 1:159844314-159844336 GGAGACAGGCAAACTGCAGCAGG - Intronic
916618936 1:166474261-166474283 GGACACAGCCAAACCATATCAGG + Intergenic
916809972 1:168296642-168296664 GGACATAGCCAAACCATATCTGG + Intronic
917277673 1:173348120-173348142 GGACACAGCAAAACCATATTAGG - Intergenic
917396837 1:174602541-174602563 GGACACAGTCAGACTATATCAGG + Intronic
917424650 1:174901586-174901608 GGACACAGCCAAACCATATCAGG + Intronic
917530224 1:175828508-175828530 GGACACAGCCAAACCATATCAGG + Intergenic
918049362 1:180960782-180960804 GGACACAGCCAAACCATATCAGG + Intergenic
918127594 1:181597982-181598004 GGACACAGCCAAACTATATCAGG + Intronic
918352315 1:183670025-183670047 GGACACAGCCAAACCATATCAGG + Intronic
918670439 1:187208173-187208195 GGACACAGCCAAACCATATCAGG + Intergenic
918673191 1:187246730-187246752 GGACAGAGCCAAACCATATCAGG + Intergenic
918724024 1:187894340-187894362 GGACACAGACAAACCATATCAGG - Intergenic
918727631 1:187946500-187946522 GGACATAGCCAAACCATACCAGG - Intergenic
918748430 1:188238355-188238377 AGACACAGACAAATTGGATCTGG - Intergenic
918786902 1:188774997-188775019 GGACACAGCCAAACCATATCAGG - Intergenic
918787315 1:188778933-188778955 GGACACAGCCAAACCATATCAGG - Intergenic
919037990 1:192340968-192340990 GGACACAGGCAAACCATATCAGG + Intronic
919194186 1:194263007-194263029 GGACACAGACAAACTATATCAGG - Intergenic
920844003 1:209578213-209578235 TGACACAGCCCAACCATATCAGG - Intergenic
921078467 1:211719525-211719547 GGACACAGCCAAACCCCATCAGG - Intergenic
921087500 1:211809492-211809514 GGACACAGCCAAACCATATCAGG - Intronic
921115189 1:212083381-212083403 GGACACAGCCAAACCATATCAGG + Intronic
921118023 1:212112971-212112993 GGTCACAGCCAAACCATATCAGG + Intergenic
921510378 1:216021195-216021217 GGACACAGCCAAACCACATCAGG - Intronic
921989897 1:221353844-221353866 GGACACAGTCAAAACATATCAGG + Intergenic
922184934 1:223265900-223265922 GGACACATACAATCTGTATCTGG - Intronic
922332110 1:224586520-224586542 GGACACAGCCAAACCATATCAGG + Intronic
922394132 1:225178539-225178561 AGACACAGCCAAACTATATCAGG + Intronic
922565546 1:226599195-226599217 GGACACAGCCAAACCATATCAGG + Intronic
922625564 1:227038027-227038049 GAACACAGCCAAACCATATCAGG - Intronic
923204554 1:231745761-231745783 ACAAACATCCAAACTGTATCAGG - Intronic
923250656 1:232176990-232177012 GGACACAGCCAAACCATATCAGG - Intergenic
923387393 1:233478700-233478722 GGACAGAGCCAAACCATATCAGG + Intergenic
923788379 1:237090227-237090249 GGACACAGCCAAACCATATCAGG + Intronic
923910932 1:238442864-238442886 GGACCCAGCTAAGCTGTGTCTGG - Intergenic
924050622 1:240076746-240076768 CAACACAGCCAAACCATATCAGG - Intronic
924095178 1:240543587-240543609 GGACACAGCCAAACCATACCAGG + Intronic
924856654 1:247881175-247881197 GCACAAAGCCAAACCATATCGGG - Intergenic
1062900700 10:1143419-1143441 GGACACAGCCAAACCATATCTGG - Intergenic
1063014857 10:2065558-2065580 GGACAGAGCCAAACCAAATCAGG + Intergenic
1063073965 10:2695728-2695750 GGACACACCCAAACCATATCAGG + Intergenic
1063280817 10:4627695-4627717 GGACACAGCCAAACCATATGAGG + Intergenic
1063542728 10:6950606-6950628 GGTCACAGCCAAACCATATCAGG + Intergenic
1063748719 10:8917727-8917749 GGACACAGCCAAACCATATCAGG - Intergenic
1063784478 10:9365279-9365301 GGACACAGTCAAACCGTAGCAGG - Intergenic
1063910001 10:10819913-10819935 GGACAAAGCCAAACAGTATCAGG - Intergenic
1063920934 10:10932080-10932102 GGACACAGCCAGAACATATCAGG + Intergenic
1064105551 10:12498165-12498187 GGACACAGCCAAACCATATCAGG + Intronic
1064425295 10:15224479-15224501 GGACATAGCCAAACCCTATCAGG - Intronic
1064486946 10:15802573-15802595 GGACAAAGCCAAATCATATCAGG + Intronic
1064548181 10:16472304-16472326 GGACACAGTCAATCCGTATGAGG - Intronic
1064575001 10:16735886-16735908 GGGCACAGCCAAACCGTATCAGG + Intronic
1064650900 10:17508324-17508346 GGACACAGCCAAACTATATCAGG + Intergenic
1064678606 10:17786742-17786764 CGACACAGCCAAACCATATCAGG - Intronic
1064919757 10:20503789-20503811 GGACACAGCCAAACCATATCAGG - Intergenic
1064922327 10:20532461-20532483 GGACACAGCCAAACCATATCAGG - Intergenic
1065009985 10:21412245-21412267 GGACACAGCCAAGCCATATCAGG + Intergenic
1065350643 10:24792757-24792779 GGACACAGCCAAACCGAATCAGG + Intergenic
1065391969 10:25192024-25192046 AGACACAGCCAAACCGTATCAGG - Intronic
1065393103 10:25204866-25204888 GGACACAGCCAAACCATATCAGG - Intronic
1065436026 10:25704721-25704743 GAGCACAGCCAAACTGTATCAGG - Intergenic
1065451664 10:25864940-25864962 GGACACAGCCAAACCATATGAGG + Intergenic
1065460364 10:25956256-25956278 GGACACAGCCAAAGTGTAATAGG + Intronic
1065502327 10:26394518-26394540 GGACACAACCAAAGCATATCAGG + Intergenic
1065654489 10:27933921-27933943 GGACACAGCAAAATCCTATCAGG - Intronic
1065707553 10:28484576-28484598 GGACACAGCTAAACCATATCAGG + Intergenic
1065852782 10:29804763-29804785 GGACGCAGCCAAACCTTATCAGG - Intergenic
1066113058 10:32214301-32214323 GGACACAGCCAAACCGTATCAGG + Intergenic
1066184146 10:32992619-32992641 GGACACAGCCAAACCATATCAGG + Intronic
1066223280 10:33357019-33357041 GGACATAGCCAAACCGTATCAGG - Intergenic
1066223586 10:33359793-33359815 GGACACAGTGAAACCATATCAGG + Intergenic
1066392186 10:34986454-34986476 GGACACAGCCAAATCATATCAGG + Intergenic
1066482670 10:35812271-35812293 GGACACAGCCAAACCATATCAGG - Intergenic
1066498821 10:35970523-35970545 ACAAACATCCAAACTGTATCAGG - Intergenic
1066650227 10:37648097-37648119 GGACACAGCCAAACCATATCAGG - Intergenic
1067033155 10:42893888-42893910 GGATACAGCCAAACCGTATCAGG - Intergenic
1067146095 10:43694887-43694909 GGAAATAGCCGAACTATATCAGG - Intergenic
1067287605 10:44918241-44918263 GAACACAGCCAAACCATACCAGG + Intronic
1067458439 10:46440156-46440178 AGACACAGCCAAACCATATCAGG + Intergenic
1067628756 10:47944478-47944500 AGACACAGCCAAACCATATCAGG - Intergenic
1067953270 10:50764915-50764937 ACACAAAGCCAAACTATATCAGG + Intronic
1068029585 10:51690322-51690344 GGACACATCCAAACTATATCAGG + Intronic
1068322755 10:55441060-55441082 GGACACAGCCAAACCATATCAGG + Intronic
1068386445 10:56334106-56334128 GGACACAGCCAAACCATATCAGG + Intergenic
1068405992 10:56589284-56589306 GGACACAGCCAAACCACATCAGG + Intergenic
1068444961 10:57108957-57108979 GGACACAGCCAAACCATGTCAGG - Intergenic
1068519638 10:58064041-58064063 GGACAGAGCCAAACCGTATCAGG + Intergenic
1068647203 10:59480862-59480884 GGACACAGCCAAACCATATCGGG + Intergenic
1068653824 10:59554133-59554155 GGTCACAGCCAAACCATATCAGG - Intergenic
1068756250 10:60657312-60657334 GGACACAACCAAACCATATCAGG + Intronic
1068805937 10:61193797-61193819 AGACACAGCCAAACCATATAAGG + Intergenic
1069069716 10:63980832-63980854 GGACACAGCCAAACCATGTTAGG - Intergenic
1069156799 10:65039619-65039641 GGACACAGCCAAACCGTATCAGG - Intergenic
1069175900 10:65287537-65287559 GGACACAACCAAACCATATCAGG + Intergenic
1070308562 10:75255957-75255979 GGACACAGCCAAAGCATATCAGG + Intergenic
1070324161 10:75376975-75376997 ATACAGAGCCAAACTATATCAGG + Intergenic
1070439715 10:76431720-76431742 GGACACAACCAAACCATATCAGG - Intronic
1070577683 10:77691962-77691984 GGACACAGCCAAACCATATCAGG + Intergenic
1070761066 10:79024771-79024793 GGCAACAGCCAAAATCTATCAGG - Intergenic
1071244725 10:83750418-83750440 GGACACAGCCAAACCATATCAGG - Intergenic
1071245258 10:83754589-83754611 GGACACAGCGAAACCATATCAGG + Intergenic
1071246772 10:83773592-83773614 GGACACAGCCAAACCACATCAGG + Intergenic
1071699132 10:87910441-87910463 CGACACAGCGAGACTCTATCTGG - Intronic
1072201032 10:93159002-93159024 GGACACAGCCAAACCATACCAGG - Intergenic
1072293741 10:93990634-93990656 GGACACAGCCAAACCATATCAGG + Intergenic
1072364007 10:94690324-94690346 ACACACATCCAAACTATATCAGG - Intronic
1072364350 10:94693914-94693936 ACACACATCCAAACTGTATCAGG + Intronic
1073032077 10:100534708-100534730 GGACTCAGCCAACCAGTACCTGG - Intronic
1073188009 10:101628654-101628676 TGACACAGGCATACAGTATCAGG + Intronic
1073271150 10:102265280-102265302 GGACAAAGACAGACTATATCTGG - Intronic
1073689070 10:105787260-105787282 AGACACAGCCAAACCATATCAGG + Intergenic
1073847131 10:107569183-107569205 GGACACAGCCAAACCTTATCAGG + Intergenic
1073892915 10:108121728-108121750 GGACACAGCCAGACCATATCAGG - Intergenic
1073942277 10:108712626-108712648 AGACACAGCCAAACCATATGAGG - Intergenic
1074011043 10:109480477-109480499 GGACACAGCTAAACCATATTAGG - Intergenic
1074215912 10:111383588-111383610 GGACACAGCCAAACCATATCAGG - Intergenic
1074255569 10:111799056-111799078 GGACACAGCCAAACTATATCAGG - Intergenic
1074302941 10:112249413-112249435 GGACACAGTCAAACCATACCAGG - Intergenic
1074451650 10:113564328-113564350 GGACACAGCCAAACCATATTAGG + Intronic
1074491341 10:113942062-113942084 GGACACAGCCAAACCATATCAGG - Intergenic
1074640083 10:115369895-115369917 GGACATGGCCAAACCATATCAGG - Intronic
1074689535 10:115991905-115991927 GGACACAGCCAAACCATTTTAGG - Intergenic
1074690789 10:116002491-116002513 ACACACAGCCAAACCATATCAGG - Intergenic
1074717644 10:116234754-116234776 GGACACAGCCAAACCATATCAGG - Intronic
1074784732 10:116829047-116829069 GGACACAGCCAAAATATATCTGG - Intergenic
1074789500 10:116872323-116872345 GGACACAGCCAAACCATATCAGG - Intronic
1074891869 10:117742628-117742650 GGACACAGCCAAACCATATCAGG + Intergenic
1074913949 10:117938012-117938034 GGACACAGCCAAGCCATAACAGG - Intergenic
1074931925 10:118136157-118136179 GGACACAGCTAAACCATATCAGG + Intergenic
1074997134 10:118767270-118767292 GGCCACAGCTAAACTGTGTTAGG - Intergenic
1075605317 10:123801083-123801105 GGACACAGCCAAACCGTATCAGG - Intronic
1075640533 10:124061188-124061210 GCACACAGTCAAACCATATCAGG - Intronic
1075718477 10:124570892-124570914 GGATGCAGCCAAACCATATCAGG - Intronic
1075814400 10:125253738-125253760 GGACATAGCCAAACCATATCAGG - Intergenic
1075895491 10:125991071-125991093 GGACACAGCCAAACTATATCAGG + Intronic
1075941837 10:126396491-126396513 GGACACAGCCAAACCATATCAGG - Intergenic
1076155566 10:128202585-128202607 GGACACAGCCAAACCATATCAGG + Intergenic
1076168569 10:128301952-128301974 GGACACAGCCAGACCTTATCAGG + Intergenic
1076168577 10:128301989-128302011 GGACACAGCCAAACCATATCAGG + Intergenic
1076281832 10:129252866-129252888 GGACACAGCCAAACCATATCAGG + Intergenic
1076760258 10:132600970-132600992 GGACACAGCCAAACCACATCAGG + Intronic
1077202998 11:1322333-1322355 GGACACAGCCAAACCATATCAGG + Intergenic
1077293737 11:1814216-1814238 GGACACAGCCACACTGAATTAGG + Intergenic
1078201505 11:9188041-9188063 GGACACAGCCAAACCATATCCGG - Intronic
1078299452 11:10112217-10112239 GGACATAGCCAAACCATATCAGG - Intronic
1078301616 11:10136280-10136302 GGACACAGCCAAACCATATCAGG + Intronic
1078573926 11:12482888-12482910 GGACACAGCCAAACCATATTAGG + Intronic
1078612881 11:12837248-12837270 GCACACAGCCAAAGAGTATGAGG - Intronic
1078632903 11:13019697-13019719 GGACACAGCCAAACCATATCAGG + Intergenic
1078930981 11:15911989-15912011 GGACACAGCTAAGCTGTGCCTGG + Intergenic
1078936380 11:15954695-15954717 GGACACAGCCAAACCATATCAGG - Intergenic
1079176673 11:18148327-18148349 GGACACAGCCAAACCATATCAGG + Intronic
1079302851 11:19294685-19294707 GGACAGAGCCAAACCATATCAGG + Intergenic
1079590604 11:22178260-22178282 GGACACAGCCAAACTGTATCAGG - Intergenic
1079627563 11:22634359-22634381 GGACACAACCAAACCATATCAGG + Intronic
1080115275 11:28615057-28615079 GGACACAGCCAAACCATATCAGG + Intergenic
1080159009 11:29148989-29149011 GGACACAGGCAAACCATATCAGG + Intergenic
1080417059 11:32078629-32078651 GGACACAGCCAAACCATATCAGG + Intronic
1081022192 11:37960059-37960081 AGACACAGCCAAATCATATCAGG + Intergenic
1081080619 11:38734886-38734908 AGACACAGTCAAACCATATCAGG + Intergenic
1081122822 11:39287036-39287058 GGACACAGCCAAACCATATCAGG + Intergenic
1081219841 11:40446941-40446963 GGACACAGCCAAACCATATCAGG + Intronic
1081303280 11:41479626-41479648 AGACACAGCCAAACCATATAAGG - Intergenic
1081460941 11:43272473-43272495 GAACACAGCCAAACCATATCAGG - Intergenic
1081541042 11:44034750-44034772 GGACATACCCAAACCATATCAGG + Intergenic
1081546700 11:44077081-44077103 GGACACAGCCAAACCATATCAGG + Intronic
1081943125 11:46962195-46962217 GGACACAGCCAAGCCATATCAGG + Intronic
1083120276 11:60505399-60505421 ACACAGAGCCAAACCGTATCAGG + Intronic
1083251077 11:61467643-61467665 GGACATAGCCAAACTGTATCAGG - Intronic
1083519299 11:63292852-63292874 GGACACAGCCAAATCATATCAGG + Intronic
1083688235 11:64390609-64390631 GGACACAGCCAAAACATATCAGG + Intergenic
1083973418 11:66097567-66097589 GGACCCAGCTAAACTGTGCCTGG + Intronic
1084093684 11:66896097-66896119 TGACAGAGCCAGACTGTCTCCGG - Intronic
1084230346 11:67747881-67747903 GGACACAGCCAAACCGTATCAGG - Intergenic
1084413648 11:69018040-69018062 GGACACAGTCAGGCAGTATCTGG - Intergenic
1084435310 11:69136008-69136030 GGACACAGCCCAATCATATCAGG - Intergenic
1084531463 11:69730329-69730351 GGACACAGCCAAACCACATCAGG + Intergenic
1085377306 11:76076575-76076597 GGACACAGCCAAACGGTATCAGG + Intronic
1085577490 11:77620142-77620164 GGACACAGCCAAACCATATCAGG - Intronic
1085586427 11:77712098-77712120 GGACACAGCCAAACCATATCAGG - Intronic
1085732375 11:79010780-79010802 GGACACAGCCAAACCATGTCAGG + Intronic
1085860384 11:80226253-80226275 GGAAACAGCCAAGCCATATCAGG + Intergenic
1085982335 11:81739509-81739531 GGACACAGTCAAACCATATGAGG + Intergenic
1086276705 11:85138541-85138563 GGACACAACCAAACCATATCAGG - Intronic
1086314770 11:85579908-85579930 GGACACAGCCAAACCATATCAGG - Intronic
1086519384 11:87652212-87652234 GGACACAGCCAAACCATATCAGG + Intergenic
1086580515 11:88393060-88393082 GGACACAGCCAAACCATATCAGG + Intergenic
1086790040 11:91025696-91025718 GGATACAGCCAAACAATTTCAGG - Intergenic
1086791434 11:91043418-91043440 GGACACAGCCAGACCATATCAGG + Intergenic
1086960302 11:92974137-92974159 GGACACAGCCAAAGCATATCAGG - Intronic
1087009929 11:93503461-93503483 GGACACAACCAAACCATATCAGG + Intronic
1087445998 11:98253984-98254006 GGACACAGCAAAACTGTATCAGG + Intergenic
1087725632 11:101713007-101713029 TGACACAGCCAAACCATATCAGG + Intronic
1087885008 11:103470170-103470192 GGACAAAGCCAATCTGTTACTGG + Intronic
1088317760 11:108524895-108524917 GGACACAACCGAACCATATCAGG - Intronic
1088321116 11:108555565-108555587 GGACACAACCAAACCATGTCAGG - Intronic
1088435386 11:109806087-109806109 GAACACAGCCAAACCATATCAGG + Intergenic
1088519216 11:110676623-110676645 GGAAACAGCCAAACCACATCAGG + Intronic
1088526794 11:110764579-110764601 GGACACAGCCAAATCATATCAGG + Intergenic
1088545542 11:110955181-110955203 ACACACATCCAAACTATATCAGG + Intergenic
1088562972 11:111134556-111134578 GGACACAGCCAAACCATATCAGG + Intergenic
1088850683 11:113700782-113700804 GGACACAGCTAAACCATATCAGG - Intronic
1089154554 11:116391112-116391134 GAACACAGCCAAACCATATCAGG - Intergenic
1089379562 11:118018013-118018035 AGACACAGCCAAACCATACCAGG + Intergenic
1089664249 11:120007634-120007656 GGACACAGCCAAACCATATCAGG - Intergenic
1089878304 11:121747169-121747191 GGACACAGCCAAACCATATCAGG - Intergenic
1090583486 11:128185069-128185091 GGACACAGCCAAACCATATCAGG - Intergenic
1090633887 11:128676216-128676238 GGACACAGCCAAACCATATCAGG - Intergenic
1091001769 11:131915938-131915960 GGACACAGCCAGACCATATCAGG + Intronic
1092876395 12:12851872-12851894 GGACACAGCCAAACCATATTAGG + Intergenic
1093220244 12:16412520-16412542 TAACACAGCCAAACCATATCAGG - Intronic
1093416905 12:18930255-18930277 GGACACAACCAAACCATATCAGG + Intergenic
1093421398 12:18978438-18978460 GGACACAGCCAAACCATATTAGG + Intergenic
1093646124 12:21587324-21587346 GGACACAGTCAAGCTGTATCAGG - Intronic
1093810876 12:23491030-23491052 GGACACAGCCAAACCATATCAGG - Intergenic
1094157798 12:27355833-27355855 GGACAAAGCATAACTGTCTCAGG - Intronic
1094282623 12:28756217-28756239 TGACACAGCCAAACCATATCAGG + Intergenic
1094308425 12:29049067-29049089 AGACACAGCCAAACCATATCAGG + Intergenic
1094780977 12:33791153-33791175 GGACAAAGCCAAACCATATCAGG + Intergenic
1095045977 12:37506272-37506294 GGACACAGCCAAATCCTAACAGG - Intergenic
1095233289 12:39767648-39767670 AGACACAGCTAAACCATATCAGG - Intronic
1095328823 12:40932141-40932163 GGACACAGCCAAATCGTATCAGG - Intronic
1095566332 12:43628310-43628332 GGACACAGCCAAACCATATTAGG + Intergenic
1095693153 12:45113737-45113759 GGACACAGCCAAACCATATCAGG + Intergenic
1095807046 12:46331076-46331098 GGACACAGCCAAACCATATCAGG + Intergenic
1096907766 12:54951072-54951094 ACACAGAGCCAAACTATATCAGG - Intronic
1096913950 12:55012273-55012295 GGACACAGCCAAACCATATCAGG - Intergenic
1096969021 12:55650732-55650754 GGACACAGCCAAACTGTGGCAGG - Intergenic
1097364468 12:58696047-58696069 ACACAGAGCCAAACTGTATCAGG - Intronic
1097445530 12:59667244-59667266 GGACACAGCCAAACCATATCAGG + Intronic
1097478322 12:60087423-60087445 GGACACAGCCAAACCATATCAGG - Intergenic
1097515303 12:60597012-60597034 GGCCACAGCCAAATTATATCGGG + Intergenic
1098348605 12:69532677-69532699 GGACACATTCAAACTATAGCAGG + Intronic
1098371945 12:69768901-69768923 GGACACAGCCAAACCCTATCAGG - Intronic
1098648934 12:72940577-72940599 GGACACAGCCAAACCCTATTGGG + Intergenic
1099058302 12:77872893-77872915 GGACACAGCCAAACCATATCAGG - Intronic
1099122590 12:78710524-78710546 ACACACATCCAAACTATATCAGG - Intergenic
1099295374 12:80822686-80822708 GGACACAGTCAAACCATATCAGG + Intronic
1099383820 12:81989353-81989375 GGACACAGCCAAACTGTATCAGG + Intergenic
1099492915 12:83308020-83308042 GGACACAGCCAAATTGGGTGGGG - Intergenic
1099607776 12:84827697-84827719 GGACATAGCCAAACTATATCAGG - Intergenic
1099688725 12:85923057-85923079 GGACACAGCCAAACCATATCAGG + Intergenic
1099840134 12:87954708-87954730 GCACACAGCCAAACCATATCGGG - Intergenic
1099908519 12:88800755-88800777 GGACACAGCCAAAGCATATCAGG + Intergenic
1099929250 12:89054178-89054200 GGACACAGCCAAACCATATCAGG + Intergenic
1100061707 12:90586559-90586581 GGACACAGACAAACTATATCAGG + Intergenic
1100133772 12:91528655-91528677 GGACACAGCCAAATCATATCAGG - Intergenic
1100295691 12:93258761-93258783 GGACACAGTCATATTATATCAGG - Intergenic
1100383671 12:94085561-94085583 GGACACAGCCAAACCACATCAGG + Intergenic
1100603043 12:96128669-96128691 GGACACAGACAAACCATATCAGG + Intergenic
1100648728 12:96561127-96561149 GGAAACAGCCAAACCAAATCAGG - Intronic
1100666442 12:96758570-96758592 GGACACAGCCAAACCATATTAGG + Intronic
1101084497 12:101222065-101222087 GGACTCAGCCAAACCATATCAGG - Intergenic
1101111733 12:101492891-101492913 GGACACAGGCAAACCATATCAGG + Intergenic
1101215303 12:102575698-102575720 GGACACAGCCAAACCATATCGGG - Intergenic
1101258118 12:102999408-102999430 GGACACAGCCAAACCATATTAGG + Intergenic
1101511618 12:105398345-105398367 GGACACAGCCAAACCATATCAGG - Intergenic
1101538196 12:105639976-105639998 GGACACAGCCAAACCACAACAGG + Intergenic
1101684332 12:107002670-107002692 GGGCACAGCCAAACCATATCAGG - Intronic
1101694619 12:107113464-107113486 GGACACAGCCAAACCATATAGGG - Intergenic
1101763374 12:107677352-107677374 GGACACAGCCACATCATATCAGG + Intergenic
1101975060 12:109350268-109350290 GGACACAGCCAAACCATATCAGG - Intronic
1102401295 12:112631937-112631959 GGACACAACCAAACTATATCAGG - Intronic
1102704616 12:114870353-114870375 ACACACAGCCACACTGTCTCAGG + Intergenic
1102758406 12:115363776-115363798 GGACACAGCCAACCCATATCAGG + Intronic
1102758592 12:115365838-115365860 GGACACAGCCAAACCATATCAGG - Intergenic
1102928061 12:116841994-116842016 GGACACAGCTAAGTTGTACCTGG - Intronic
1103002934 12:117399482-117399504 GGACACAGTGAAACCATATCAGG + Intronic
1103015074 12:117487918-117487940 GGACACAGCCAAACCATATCAGG - Intronic
1103031552 12:117618506-117618528 GGGCACAGCCAAACCATATCAGG - Intronic
1103226170 12:119290019-119290041 GGACACAGCCAGACCATATCAGG + Intergenic
1103269176 12:119657886-119657908 GGACACAGCCAAAGCATATCAGG + Intergenic
1103331193 12:120155200-120155222 GCACACACCCAGACTGCATCAGG + Intronic
1103472236 12:121191183-121191205 GGACACAGCCAAACCATATCAGG - Intergenic
1104094792 12:125547154-125547176 GGACACAGCCAAACCATATCAGG + Intronic
1104119964 12:125789634-125789656 GGACACAGCCAAACCATATCAGG - Intergenic
1104128464 12:125869926-125869948 GAACACAGCCAAACCATACCAGG - Intergenic
1104416433 12:128599798-128599820 TGACACAGCCAAACCATATCAGG - Intronic
1104452904 12:128885895-128885917 GGACACAGCCAAACCATATCTGG - Intronic
1104510868 12:129376550-129376572 GGACACAGCCAAACCATATCAGG + Intronic
1104528734 12:129549044-129549066 GGACACAGCCAAACCATATCAGG - Intronic
1104528778 12:129549307-129549329 GGACACAGCTAAACCATATCAGG - Intronic
1104608488 12:130207180-130207202 GGACACAGCCAAACCATATCAGG - Intergenic
1104617699 12:130284258-130284280 GGACACAGCCAAACTATATCAGG - Intergenic
1104656885 12:130580223-130580245 GGACACAGCCAAACCATATGGGG - Intronic
1104746410 12:131213716-131213738 GGGCACAGCCAAACCATATCAGG + Intergenic
1105534038 13:21247634-21247656 GGAAGCAGCCAAACTGGAGCTGG + Intergenic
1105622831 13:22085652-22085674 GGACACCGCCAATCTATAACAGG - Intergenic
1106046491 13:26146780-26146802 GCACAGAGCCAAACCATATCAGG - Intronic
1106126397 13:26903297-26903319 GGACACAGCCAAACCATATCAGG - Intergenic
1106241203 13:27915100-27915122 CGACAGAGCAAAACTCTATCTGG + Intergenic
1106526807 13:30548087-30548109 GGACACAGCCAAACTCTATCAGG - Intronic
1106594985 13:31128101-31128123 AGACACAGCCAAACCATATCAGG - Intergenic
1106689982 13:32104653-32104675 GGACACAGCCAAACCATATCAGG - Intronic
1107096235 13:36539671-36539693 ACACAGAGCCAAACTATATCAGG - Intergenic
1107102019 13:36603372-36603394 GGACACAGCCAAACCATATCAGG + Intergenic
1107330552 13:39295426-39295448 GGACACAACCAAACCATATCAGG - Intergenic
1107344101 13:39440720-39440742 GGACACAGCCAAACCATATCCGG - Intronic
1107474340 13:40720805-40720827 GGACACAGCCAAACCATATCAGG - Intergenic
1107669894 13:42734532-42734554 GGACACAACCAAACCATATCAGG - Intergenic
1107693863 13:42980671-42980693 GGACACAGCCAAACCATATTAGG + Intronic
1107886433 13:44877777-44877799 GGACACAGCCAAACCATATCAGG - Intergenic
1107896046 13:44965003-44965025 GGACACAACCAAACCACATCAGG - Intronic
1107950037 13:45453418-45453440 AGAAACATCCAAACTATATCAGG + Intergenic
1108065827 13:46576872-46576894 GAATCCAGCCAAACTGTGTCTGG - Intronic
1108109724 13:47055818-47055840 GGACACAGCCAAACCATATCAGG + Intergenic
1108164404 13:47677112-47677134 AGACACAGCCAAACCATATCAGG + Intergenic
1108701055 13:52944564-52944586 GGACCCAGCCAAACCATATCAGG + Intergenic
1108889393 13:55234418-55234440 AGACACAGCCAAACTATATCAGG - Intergenic
1108933815 13:55863290-55863312 GGACACAGCCAAACCCTATTGGG - Intergenic
1109344464 13:61098617-61098639 GGACACAGCCAAACCATGTCAGG - Intergenic
1109579492 13:64308174-64308196 GGACACAGCCAAACCATATCAGG + Intergenic
1109714717 13:66206254-66206276 GGACACAGACAAACCATACCAGG + Intergenic
1109740885 13:66553127-66553149 CGACATAGCCAAACTATATCAGG + Intronic
1109888458 13:68574881-68574903 GGACACAGCAAAACCATATCAGG + Intergenic
1109987749 13:70012156-70012178 GGACACAGCCAAATCATATCAGG + Intronic
1110025485 13:70533570-70533592 GGACATAGCCAAACCATATCAGG - Intergenic
1110086015 13:71380562-71380584 GGACACAGCCAAACCATATAGGG + Intergenic
1110169627 13:72485173-72485195 ACACATAGCCAAACCGTATCAGG - Intergenic
1110342667 13:74411713-74411735 GGACAAAGCCAAACCATATCAGG - Intergenic
1110346096 13:74449484-74449506 GGACACAGCCAAATCATATCAGG + Intergenic
1110455658 13:75687839-75687861 GGACACAGCAAAACAATATCAGG - Intronic
1110456760 13:75697600-75697622 GGACACAGCCAAACCATATCAGG + Intronic
1110477018 13:75928107-75928129 GGACACAGTCAAACTATATCAGG - Intergenic
1110960235 13:81612356-81612378 GGACACAGCCAAACCATATCAGG + Intergenic
1111045759 13:82811645-82811667 GGACACAGCCAAACCATATCAGG - Intergenic
1111218970 13:85179897-85179919 GGACACAGCTAAACCATATCAGG + Intergenic
1111254428 13:85647517-85647539 GGACACAGCCAAACCATATCAGG - Intergenic
1111388339 13:87559908-87559930 GGACACAGCCAAACCATATCAGG + Intergenic
1111529041 13:89512162-89512184 GGATACAGCCAAATCATATCAGG + Intergenic
1111620674 13:90721458-90721480 GGAAACAGCCAAACCATATCAGG - Intergenic
1111819154 13:93192834-93192856 GGACATAGCCAAACCACATCAGG - Intergenic
1111986426 13:95070901-95070923 GGACACAGCCAAACATTATCAGG - Intronic
1112118963 13:96388623-96388645 GGACACAGCCAAACCATATCAGG - Intronic
1112159525 13:96853346-96853368 GGACACAGCCAAACCATATCGGG - Intergenic
1112242361 13:97694658-97694680 GGACACAGACAAACCATATCGGG + Intergenic
1112341877 13:98559205-98559227 GGACACAGCCAAACCATATCAGG - Intronic
1112370185 13:98787208-98787230 ACACAAAGCCAAACCGTATCAGG - Intergenic
1112499826 13:99934220-99934242 ACACAGAGCCAAACAGTATCAGG + Intergenic
1112586918 13:100726844-100726866 AGACACAGCCAAACCATATCAGG - Intergenic
1112651215 13:101400745-101400767 GGACACAGCCAACCCATATCAGG - Intronic
1112942910 13:104888281-104888303 GGACACAGCCAAATCATATCAGG - Intergenic
1112994467 13:105556276-105556298 GGACACAACCAAACCACATCAGG - Intergenic
1113280348 13:108781659-108781681 GGACACAGGCAAACCATATCAGG - Intronic
1113391810 13:109905070-109905092 GAACAGAGCCAAACCATATCAGG - Intergenic
1113401006 13:109993252-109993274 GGACACAGCCAAACCGTATCAGG - Intergenic
1113526188 13:110979532-110979554 GGACACAGCAAAAACATATCTGG + Intergenic
1113928066 13:113952205-113952227 GGACACAGCCAAGGTGTAGCTGG + Intergenic
1114599368 14:23942004-23942026 ACAAACATCCAAACTGTATCAGG + Intergenic
1114762803 14:25335407-25335429 GGACACAGCCAAATTATATCGGG + Intergenic
1114804978 14:25824696-25824718 GGACACAGCCAAACCATATCAGG + Intergenic
1114839617 14:26248058-26248080 GGTCACAGACAAACCATATCAGG - Intergenic
1115053113 14:29089287-29089309 GGACACAGGCAAACCATATCAGG - Intergenic
1115076855 14:29403258-29403280 GGACACACCCAAGCCATATCAGG + Intergenic
1115112524 14:29840909-29840931 GGACACAGCCAAACCGTATCAGG + Intronic
1115199283 14:30835576-30835598 GGATACAGCCAAACCATATCGGG + Intergenic
1115263145 14:31473724-31473746 GGACACAGCCAAACCATATCAGG + Intergenic
1115547138 14:34474242-34474264 AGACACAGCCAAGCCATATCAGG - Intergenic
1115963828 14:38864920-38864942 GGACACAGTCAAACCATATCAGG - Intergenic
1115990293 14:39143486-39143508 GGACACAGCCAAACCATATCAGG + Intergenic
1115998477 14:39217719-39217741 GGACACAGCCCAACCATATCAGG + Intergenic
1116085826 14:40236652-40236674 TGACACAGCCAAACCATATAAGG - Intergenic
1116088153 14:40267888-40267910 AGACACAGCCAAACCATATCAGG + Intergenic
1116147784 14:41098450-41098472 GGACACAGCCAAACAATACCAGG - Intergenic
1116281685 14:42916011-42916033 GGACACAGTCAAAGCATATCAGG + Intergenic
1116302654 14:43204623-43204645 ACACACAGCCAAACTGTATCAGG + Intergenic
1116812032 14:49548461-49548483 GGACACAGCCAAACCATATCAGG - Intergenic
1116944038 14:50819279-50819301 GGACACAGCCAAACCATATCAGG - Intronic
1116969534 14:51050198-51050220 GGACACAGCCAAACCATATCAGG - Intronic
1117106944 14:52407548-52407570 GGACACAGCAAAACCATGTCAGG - Intergenic
1117193100 14:53312892-53312914 GGACGTAGCCAAACCATATCAGG + Intergenic
1117205615 14:53439898-53439920 GGACACAGCCAAACCACATCAGG + Intergenic
1117234165 14:53753934-53753956 GGACACAGCCAAACCATATCAGG - Intergenic
1117447385 14:55817331-55817353 TGACACAGCAAGACTGTCTCAGG + Intergenic
1117497350 14:56318773-56318795 GGACACAGCCAAACCATACCAGG + Intergenic
1117497483 14:56319927-56319949 ACACACATCCAAACTATATCAGG - Intergenic
1117508458 14:56425394-56425416 GGACACAGCCAAACCATATCAGG - Intergenic
1117641829 14:57808129-57808151 TGACACAGCCAAGCCATATCAGG + Intronic
1117832008 14:59761219-59761241 GGACACAGCCAAACCATATCAGG - Intronic
1117901141 14:60534745-60534767 AGACACAGCCAAACCATATCAGG - Intergenic
1118102725 14:62624702-62624724 GGACATAGTCAAACCATATCAGG + Intergenic
1118139158 14:63060964-63060986 GGACACAGCCAAACCATATCAGG - Intronic
1118661290 14:68015730-68015752 GGACACAGCCAAACCATATCAGG + Intronic
1118925236 14:70185996-70186018 GGACACAGCCAAGCCATATTTGG - Intronic
1119033783 14:71212999-71213021 GGACACAGCCAAACCATCTCAGG - Intergenic
1119306056 14:73609078-73609100 GGACACAGCCAAACCATATCAGG + Intergenic
1119454850 14:74746023-74746045 GGACACAGTCAAACCATATCAGG + Intergenic
1119482439 14:74966567-74966589 GGATACAGCCAAACCATATCAGG + Intergenic
1119795115 14:77389364-77389386 GAACACAGCCAAAGGGTATTTGG - Intronic
1119902672 14:78274544-78274566 GGACACAGCAAAACCGTATCAGG + Intronic
1120038039 14:79720368-79720390 GGACACAACCAAACCATATCAGG + Intronic
1120067777 14:80064103-80064125 GGACACAGCCAAATCATATCAGG + Intergenic
1120141199 14:80931909-80931931 AGACACAGCCAGACTATATTAGG - Intronic
1120166498 14:81207190-81207212 GAATACAGCCAAACCATATCAGG - Intronic
1120281111 14:82439112-82439134 ACACAGAGCCAAACTATATCAGG - Intergenic
1120285295 14:82493028-82493050 GGACATAGCCAAACCATATCAGG - Intergenic
1120286435 14:82507955-82507977 AGACACAGCCAAACCATATCAGG - Intergenic
1120407105 14:84103754-84103776 GAACACAGCCAAACCATATCAGG + Intergenic
1120479595 14:85033675-85033697 GGACACAGCCAAACAATATCAGG - Intergenic
1120609516 14:86623120-86623142 GGACACAGCCAAACCATATTAGG - Intergenic
1120613227 14:86668519-86668541 GGACACAGCCAAACCATATCAGG + Intergenic
1120644545 14:87058032-87058054 GAACACAGCCAAACTATATCAGG - Intergenic
1120758459 14:88265634-88265656 GGACACAGCCAAACCATATCAGG - Intronic
1120843416 14:89106530-89106552 GGACACAGCCAAACCATATCAGG - Intergenic
1120860460 14:89250676-89250698 GGACACAGCCAACCCATATCGGG - Intronic
1120913276 14:89687493-89687515 GGACACAACCAAACCATATCAGG + Intergenic
1120965638 14:90165237-90165259 GGACACGGCCAAACCATATCAGG + Intronic
1121012162 14:90526545-90526567 GGACACAGCCAAACCATATCAGG - Exonic
1121162935 14:91761877-91761899 GAAAACATCCAAACTGTATCAGG - Intronic
1121211845 14:92213159-92213181 GGACACAGCCAAACCTTATCAGG - Intergenic
1121424198 14:93836661-93836683 AGACACAGCCAAACCATATCAGG + Intergenic
1121429080 14:93874180-93874202 GGACACAGTCAAACCATATCAGG - Intergenic
1121462494 14:94092703-94092725 GGACACAGCTAAACCATATCAGG - Intronic
1121490156 14:94352579-94352601 GGACACAGCCAAACCATATCAGG + Intergenic
1121659785 14:95626094-95626116 GGACACAGCCAAACCATATCAGG + Intergenic
1121679207 14:95778688-95778710 GTACACAGCAAAACCATATCAGG - Intergenic
1121778647 14:96607557-96607579 GGACACAGCCAAACCATATCAGG - Intergenic
1121914578 14:97824988-97825010 GGACACAGCCAAGCTATATTAGG + Intergenic
1121983168 14:98472633-98472655 GAACACAGCCAAACCATATCAGG - Intergenic
1122026406 14:98880655-98880677 GGACACAGACAAACCATATCAGG - Intergenic
1122098314 14:99387364-99387386 GAACACAGCCACACCATATCAGG + Intergenic
1122490092 14:102109304-102109326 GGACACAGCCAAACCGTATCAGG - Intronic
1122909786 14:104821856-104821878 GGACACAGTCACACAGGATCAGG + Intergenic
1123046244 14:105517597-105517619 GGACACAGCCAAACCATGTCAGG - Intergenic
1123571895 15:21620319-21620341 GGACACAGCCAAACCATATCAGG + Intergenic
1123608510 15:22062913-22062935 GGACACAGCCAAACCATATCAGG + Intergenic
1123876218 15:24626630-24626652 GGACACAGCCGAACAATATCAGG - Intergenic
1124029518 15:25997155-25997177 GGACACAGCCAAACCATATCAGG + Intergenic
1124045860 15:26149173-26149195 CGACACAGCCAGACTCTGTCTGG + Intergenic
1124053371 15:26219883-26219905 GGACACACCCAAACCATATCAGG - Intergenic
1124511136 15:30326902-30326924 GGACACAGCCAAACCATATCAGG - Intergenic
1124731778 15:32203863-32203885 GGACACAGCCAAACCATATCAGG + Intergenic
1124821348 15:33048917-33048939 GGACACAGCCAAACTGTATCAGG + Intronic
1124845692 15:33287885-33287907 AGACACAGCGAAATCGTATCAGG - Intergenic
1124946418 15:34271115-34271137 AGACACAGCCAAACCATATCAGG + Intronic
1125121659 15:36166416-36166438 CAACACAGCCAAACCATATCAGG + Intergenic
1125356575 15:38822803-38822825 ATACACAGCCAAACTGTATCAGG - Intergenic
1125660683 15:41392414-41392436 GGAGACAGCCAAACCATATCAGG - Intronic
1126022645 15:44417732-44417754 ACACAGAGCCAAACTGTATCAGG + Intergenic
1126289134 15:47052242-47052264 GGACACAGCCAAACCCTAACAGG + Intergenic
1126400024 15:48258941-48258963 GAACACAGCCAAACCATATCAGG + Intronic
1127145160 15:56015880-56015902 GGACACAGCCAAGCCATATCAGG + Intergenic
1127282498 15:57503939-57503961 GGACACAGCCAAATCATATCAGG + Intronic
1127497464 15:59526507-59526529 GGACACAGCCAAACTATATCAGG - Intergenic
1127581560 15:60343470-60343492 ACACAGAGCCAAGCTGTATCAGG + Intergenic
1127840764 15:62829553-62829575 GGACACAGCCAAACAATATCAGG + Intronic
1127909165 15:63401828-63401850 GGGGACAGCCAAACCATATCAGG - Intergenic
1128688999 15:69708979-69709001 GGACACAGCCAAACCATATCAGG + Intergenic
1129069962 15:72942543-72942565 GGACACATTCAAACTGTAACAGG + Intergenic
1129759540 15:78121450-78121472 GGACACAGCCAAACCATATCAGG - Intronic
1129944510 15:79527287-79527309 GGACACAGCCATATTGGATTAGG + Intergenic
1130147700 15:81287101-81287123 GGACACAGACAAACCATATCAGG + Intronic
1130168859 15:81491261-81491283 GGACGCAGGCAAACCATATCAGG + Intergenic
1130523590 15:84684196-84684218 GACCACAGCCAAACCATATCAGG - Intronic
1130731350 15:86496027-86496049 ACACAGAGCCAAACTATATCAGG - Intronic
1131386928 15:92015576-92015598 GGACACAGCCAAACCATATTGGG + Intronic
1131394700 15:92077238-92077260 GGACACAGCGAAACCATATCAGG + Intronic
1131464200 15:92642416-92642438 GGACACAGCCAAACCATATCAGG - Intronic
1131619720 15:94054829-94054851 GTACACAGCCAAACCATATCAGG - Intergenic
1131624600 15:94104279-94104301 GGATACAGCCAAACCATATTAGG - Intergenic
1131649547 15:94383779-94383801 GGACACAACCAGACCGTATCAGG + Intronic
1131774415 15:95778762-95778784 GGACACATTTAAACTGTAGCAGG + Intergenic
1132141599 15:99401502-99401524 GGACACAGCCAAACCATATCAGG + Intergenic
1202980750 15_KI270727v1_random:354709-354731 GGACACAGCCAAACCATATCAGG + Intergenic
1133133801 16:3695089-3695111 GGACACAGTCATACTGGATTAGG + Intronic
1133383405 16:5349650-5349672 TGACAGAGCAAAACTGTGTCTGG + Intergenic
1133442010 16:5828937-5828959 GGACCCAGCTAAGCTGTGTCTGG - Intergenic
1133473382 16:6096946-6096968 GGACACAGCCAAACCATACCAGG - Intronic
1133504731 16:6400056-6400078 GGACACAGCCAAATCATATCAGG + Intronic
1133606173 16:7390264-7390286 ACACACAGCCAAACCATATCAGG + Intronic
1133815445 16:9194062-9194084 ACACAGAGCCAAACTATATCAGG - Intergenic
1133894150 16:9909325-9909347 GGACAATGCCAAACCATATCAGG + Intronic
1134083897 16:11343307-11343329 GGACACAGCCAAACCATATTAGG + Intronic
1134277860 16:12792568-12792590 GGACACAGCCAAACCATATCAGG - Intronic
1134333633 16:13273306-13273328 GAATACAGCCAAACCATATCAGG - Intergenic
1134356750 16:13489433-13489455 AGACACAGCCAAGCCATATCAGG - Intergenic
1134566626 16:15257352-15257374 GGATACAGCCAGACCATATCAGG + Intergenic
1134583058 16:15388083-15388105 GGGCGCAGCCAAACCATATCGGG - Intergenic
1134735868 16:16499347-16499369 GGATACAGCCAGACCATATCAGG - Intergenic
1134874453 16:17684651-17684673 GGACACAGCCAAACCATATCAGG - Intergenic
1134931651 16:18212807-18212829 GGATACAGCCAGACCATATCAGG + Intergenic
1135168959 16:20166069-20166091 ACACAGAGCCAAACCGTATCAGG + Intergenic
1135284863 16:21184798-21184820 GGACGCAGCCTAACCATATCAGG - Intergenic
1135314560 16:21433622-21433644 GGACGCAGCCAAACCATATCGGG - Intronic
1135367483 16:21865902-21865924 GGACGCAGCCAAACCATATCGGG - Intronic
1135444331 16:22505260-22505282 GGACGCAGCCAAACCATATCGGG + Intronic
1135655047 16:24240760-24240782 GGACACAGCCAAACCATATCAGG + Intergenic
1135862291 16:26067682-26067704 GGACACAGCCAAACCATATCAGG - Intronic
1135968659 16:27056136-27056158 GGACACAGCCAAACCCTATCAGG - Intergenic
1135988517 16:27202502-27202524 GGACACAGCCAAACCATATCAGG - Intergenic
1135995772 16:27247119-27247141 GGACACAGCCAAACCATATTGGG - Intronic
1136085501 16:27882008-27882030 GGACACAGCCAAATCACATCAGG - Intronic
1136185843 16:28588438-28588460 GGACACAGGCAAACTGCCTTCGG - Intronic
1136193225 16:28631294-28631316 GGACGCAGCCAAACCATATCGGG + Intergenic
1136311229 16:29412303-29412325 GGACGCAGCCAAACCATATCGGG - Intergenic
1136324673 16:29514100-29514122 GGACGCAGCCAAACCATATCGGG - Intergenic
1136439358 16:30254085-30254107 GGACGCAGCCAAACCATATCGGG - Intronic
1136728669 16:32384988-32385010 ACACAAAGCCAAACTATATCAGG + Intergenic
1137227899 16:46532579-46532601 GGACACAGCAAAACTATATCAGG - Intergenic
1137270139 16:46897842-46897864 GGAGACAGCCAGAGGGTATCAGG - Intronic
1137490513 16:48928478-48928500 GGACACAGCCAAACCGTATCAGG + Intergenic
1137776033 16:51055009-51055031 GGACACAGCCAAACCATATCGGG + Intergenic
1137944622 16:52722012-52722034 GGGCACAGCCAAACCATATCAGG - Intergenic
1138071529 16:53997384-53997406 GGACACAGCCAAACCGTATCAGG + Intronic
1138297711 16:55901010-55901032 GGACACAGCCAAACCATATGAGG - Intronic
1138310265 16:56017537-56017559 ACACAGAGCCAAACCGTATCAGG + Intergenic
1138588883 16:57988629-57988651 GGACACAGCCAAACCATATCAGG + Intergenic
1138695223 16:58806792-58806814 GGACAGAGCCAAACCATATCAGG + Intergenic
1138861203 16:60759641-60759663 GGACACAGCCAAACCATATCAGG + Intergenic
1138895614 16:61200284-61200306 GGACAGAGCCAAACTATATCAGG - Intergenic
1139011029 16:62634250-62634272 ACACAGAGCCAAACCGTATCAGG + Intergenic
1139029207 16:62859083-62859105 GGACACAGCCAAACCATACCAGG - Intergenic
1139110245 16:63881533-63881555 GGACACAGCCAAATCATATCGGG + Intergenic
1139245046 16:65433396-65433418 GAACACAGTCAAACCATATCAGG - Intergenic
1139343213 16:66284858-66284880 GGACACAGCCAAACCATATCAGG + Intergenic
1139684483 16:68592215-68592237 GGACACAGCCAAACCATACTGGG - Intergenic
1139858745 16:70003235-70003257 GGGCGCAGCCAAACCATATCAGG - Intergenic
1139885864 16:70206383-70206405 GGATGCAGCCAAACCATATCGGG - Intergenic
1140201583 16:72899173-72899195 GGACACAGCCAAACTATATCAGG - Intronic
1140293792 16:73688685-73688707 GGACACAGCCAAACCATATCAGG - Intergenic
1140323980 16:73982096-73982118 GGACACAGCCAAACCATATCAGG + Intergenic
1140782457 16:78309104-78309126 GGATGCAGCCAAACCATATCAGG - Intronic
1141001304 16:80311080-80311102 AGACACAGCCAAACCATATCAGG - Intergenic
1141225330 16:82109582-82109604 AGACACAGCCAAACCATGTCAGG + Intergenic
1141322558 16:83025619-83025641 GGACACAGCCAAACCATATCAGG + Intronic
1141339482 16:83189753-83189775 GGACACAGCCAAACCACACCAGG - Intronic
1141792972 16:86249151-86249173 GGACACAGCCAAACCATATCAGG - Intergenic
1141859307 16:86705592-86705614 GGACACAGCCAAACCCTATCAGG - Intergenic
1142111897 16:88337147-88337169 GGACACAGCCAAACCATACCAGG - Intergenic
1202997768 16_KI270728v1_random:132755-132777 ACACAAAGCCAAACTATATCAGG - Intergenic
1203024455 16_KI270728v1_random:445097-445119 ACACAAAGCCAAACTATATCAGG - Intergenic
1142570966 17:873972-873994 GTACACAGCCAAACCATGTCAGG - Intronic
1142798840 17:2331336-2331358 AGACACATCTGAACTGTATCAGG - Intronic
1143362095 17:6380357-6380379 GCACATATCCAAACTGTATCAGG - Intergenic
1143908732 17:10229962-10229984 AGACACAACCAAACCATATCAGG - Intergenic
1143932017 17:10438796-10438818 GGACACAGCCAAACCATATCAGG + Intergenic
1144028876 17:11302176-11302198 GGGCACAGCCAAACCATATCAGG + Intronic
1144187422 17:12809649-12809671 GGACACAGCCAAACCATATCAGG + Intronic
1144229993 17:13192381-13192403 GGACACAGCTAAACCATATAAGG - Intergenic
1146319935 17:31839230-31839252 GGACACAGCCAAACTGTATCAGG - Intergenic
1146448487 17:32952530-32952552 GGACAGAGCCAAGCCATATCAGG - Intergenic
1146738282 17:35258524-35258546 GGACACAGTCAAATCATATCAGG + Intronic
1146822789 17:35998149-35998171 GGACACAGCTGCCCTGTATCTGG + Intronic
1146906823 17:36623243-36623265 TAACACAACCAAACTGTCTCAGG - Intergenic
1146995577 17:37317541-37317563 CGACACAGCAAGACTCTATCTGG + Intronic
1148139853 17:45320529-45320551 GGCCACAGCCAAACCACATCAGG + Intergenic
1148244356 17:46020849-46020871 GGACACAGCCAAACCATATCAGG + Intronic
1148628007 17:49085071-49085093 GGACACAGCCAAACCATATCAGG - Intergenic
1149309018 17:55376210-55376232 GAACACAGCCAAACCATATCAGG + Intergenic
1149358266 17:55866769-55866791 GGACACAGTCAAGCCATATCAGG - Intergenic
1149569705 17:57663683-57663705 GGACACAGCAAAACTGGACTAGG - Intronic
1149575587 17:57709893-57709915 GGACACAGCCGAACCATATCAGG - Intergenic
1150329831 17:64285833-64285855 GGACACAGCCAAACCATATCAGG - Intergenic
1150649548 17:67000952-67000974 GGACACAGCCAAACCATATCAGG - Intronic
1150649803 17:67002389-67002411 GGACATAGCCAAACCATATCAGG + Intronic
1150813159 17:68372689-68372711 ACACAGAGCCAAACCGTATCAGG + Intronic
1150844156 17:68638215-68638237 GGACGCAGCCCAACTGTATCAGG + Intergenic
1150941631 17:69699546-69699568 GGATACAGCCAAACCATATCAGG + Intergenic
1150949419 17:69785600-69785622 GGACACAGCAAAACCATATCAGG - Intergenic
1151017706 17:70576555-70576577 GGACACAGCCAAACCATATCAGG - Intergenic
1151029615 17:70721552-70721574 GGACACAGCCAAAATATATCAGG - Intergenic
1151129401 17:71880750-71880772 GGACACAGCCAAACCATATCAGG + Intergenic
1151189981 17:72391240-72391262 GGACACAACCAAACCATATCAGG + Intergenic
1151206839 17:72514107-72514129 GGACACAGCCAAACCATATCAGG - Intergenic
1151248889 17:72818144-72818166 GGATACAGCCAAACCATATCAGG + Intronic
1151257881 17:72893438-72893460 CGACACAGCAAGACTGTCTCAGG + Intronic
1151270665 17:72993144-72993166 GGACACAGCCAAACCATATCGGG + Intronic
1151270744 17:72993855-72993877 GGACACAGCCAAACCATATTGGG - Intronic
1151291143 17:73150996-73151018 GGACACAGCCAAACCATATCAGG + Intergenic
1151997691 17:77620641-77620663 GGACACAGCCAAACTATATAAGG + Intergenic
1153044028 18:839314-839336 GGACACAGCCAAACCATATCAGG + Intergenic
1153054897 18:936149-936171 GGACACAGCCAAACCATATCAGG - Intergenic
1153084972 18:1274896-1274918 ACACACAGCCAAACAATATCAGG - Intergenic
1154257088 18:12792118-12792140 GGACACAGTAATACTGAATCAGG + Intronic
1155686274 18:28555807-28555829 GGATACAGCCAATCCATATCAGG - Intergenic
1155883298 18:31177340-31177362 GGACACAGCCAAACCATATCAGG - Intergenic
1155943059 18:31819151-31819173 GGACACAGCCAAACCATATCAGG - Intergenic
1156102657 18:33616697-33616719 GGACACTGCCAACCTTAATCTGG - Intronic
1156169071 18:34460582-34460604 GGACACAGTCAAACCATATCAGG - Intergenic
1156397813 18:36715120-36715142 GAACACAGCCAAACCTCATCAGG - Intronic
1156507283 18:37605924-37605946 GGACACAGCCAAACCATATCAGG - Intergenic
1156530217 18:37807875-37807897 GGAAAAAGCCAAACCATATCAGG - Intergenic
1156592814 18:38510658-38510680 GGACACAGCAAAACCATATCAGG - Intergenic
1156670117 18:39458765-39458787 AGACATAGCCAAACCATATCAGG - Intergenic
1156819765 18:41357957-41357979 GGACACAGCCAAATCATATCAGG + Intergenic
1156827519 18:41449360-41449382 AGACACAGCCAAACCATATCAGG + Intergenic
1157003233 18:43551607-43551629 GGACAGAGCCAAAACATATCAGG + Intergenic
1157004714 18:43568232-43568254 GGACACAGCCAAATTGTATCAGG + Intergenic
1157082806 18:44546285-44546307 GGACACTTCCAAACTGTATCAGG - Intergenic
1157098714 18:44710798-44710820 GCACACAGCCAAACTGTTTTGGG + Intronic
1157284931 18:46371263-46371285 GGACACAGCCAAACCCTATCAGG + Intronic
1157719432 18:49912444-49912466 GGACACAGCCAAACCATATCAGG - Intronic
1157748253 18:50156280-50156302 GGACACAGCCAAACCATATCAGG - Intronic
1157781754 18:50445763-50445785 GGACACAGCCAAACCATATCAGG + Intergenic
1157819585 18:50756295-50756317 GGACACAGCCAAACTGTATCAGG - Intergenic
1158060605 18:53336051-53336073 GAACACAACCAAACCATATCAGG + Intronic
1158166388 18:54546166-54546188 GGACACAGCCAAATCATATCAGG - Intergenic
1158487415 18:57879910-57879932 GGACACAGCCAAACCATATCAGG - Intergenic
1158512884 18:58107141-58107163 GGACACAGCCATATTGGATTAGG + Intronic
1158550794 18:58434224-58434246 GGACACAGTCAAACCATATCAGG - Intergenic
1158702654 18:59762672-59762694 ACACACATCCAAACTATATCAGG - Intergenic
1158710095 18:59829916-59829938 GGACACAGCCAAGCCATATTGGG + Intergenic
1158728093 18:59993157-59993179 GGACACAGCCAAACCATACCAGG - Intergenic
1158766588 18:60457579-60457601 GGACACAGCTAAACCATATCAGG + Intergenic
1159196320 18:65121292-65121314 GGACACAGTCAAACCATATCAGG - Intergenic
1159325112 18:66904685-66904707 GGACACAGCCAAACCATATCAGG - Intergenic
1159362256 18:67420330-67420352 ACACATACCCAAACTGTATCAGG + Intergenic
1159507863 18:69359600-69359622 GGACACAGCCAAACCATATCAGG - Intergenic
1159748227 18:72266821-72266843 GGACACCACAAAACTGTATTTGG - Intergenic
1159750256 18:72292463-72292485 GGACACAGCCAAACCATATCAGG - Intergenic
1159760347 18:72418587-72418609 GGACACAGCCAAGCCATATCAGG - Intergenic
1159763292 18:72455455-72455477 GGACACAGCCAAATGATATCAGG - Intergenic
1159776533 18:72609067-72609089 GAACACAGCCAACCCATATCAGG + Intronic
1159785792 18:72712718-72712740 GGATACAGCCAAACCATATCAGG + Intergenic
1159851368 18:73530434-73530456 GTGCACAGCCAAACCATATCAGG + Intergenic
1159962587 18:74567174-74567196 GGACACAGCCAAACCACATCAGG + Intronic
1160021896 18:75187685-75187707 GGACACAGCAAAACCTTATCAGG - Intergenic
1160119664 18:76118660-76118682 GGACACAGCCAAACTACATGAGG + Intergenic
1160261006 18:77294192-77294214 GGACACAGCCTAACCACATCAGG - Intergenic
1160375056 18:78405516-78405538 GGACACAGCCAGACCCTATTAGG + Intergenic
1160468209 18:79100997-79101019 GGACACAGCCAAACCATATCAGG + Intronic
1160627404 18:80220357-80220379 GGACACAGCCAAACCATATCAGG + Intronic
1161780974 19:6291777-6291799 ACACAGAGCCAAACTGTATCAGG + Intergenic
1162593439 19:11608296-11608318 GGGCACAGCCAAACCGTATCAGG + Intronic
1162867728 19:13561550-13561572 GGACACAGCCAAATCATATCAGG + Intronic
1162922634 19:13912590-13912612 GGAGTCATCCAAACTGTACCTGG - Exonic
1163212345 19:15850431-15850453 ACAGACAGCCAAACTATATCAGG + Intergenic
1163346407 19:16745337-16745359 AGACACAGCCAAACCATATCAGG + Intronic
1163375377 19:16927124-16927146 GGACACAGCCAATCCATATCAGG - Intronic
1163472063 19:17503237-17503259 GGACACAGCCAAAATATATCAGG + Intronic
1163563871 19:18038064-18038086 GGTTACAGCCATACTGAATCAGG + Intergenic
1164579151 19:29423762-29423784 GGACACAGCTAAACCATGTCAGG - Intergenic
1164603816 19:29581449-29581471 GGACACAGCCAAACCATATCAGG + Intergenic
1164933615 19:32194607-32194629 GGACACAGCCAAACCATATCAGG + Intergenic
1166619105 19:44279878-44279900 GGACACAGCCAAACCATATCAGG - Intronic
1166934658 19:46323966-46323988 GGACGCAGCCAAACCCTATCAGG + Intronic
1167759412 19:51435740-51435762 GGACACAGCCAAACCATATCAGG + Intergenic
924993489 2:336769-336791 GGACACAGCCAAACCATATCAGG - Intergenic
925207448 2:2019100-2019122 GGACACAGCGAAACCATATCGGG - Intronic
925478903 2:4248418-4248440 GGACACAGCCACACCATATCAGG + Intergenic
925746729 2:7050133-7050155 GGACACAGCCAAACCATATCAGG - Intronic
925849241 2:8064912-8064934 GGACACAGCCAAACCATATCAGG + Intergenic
925850553 2:8077261-8077283 GGACACAGCCAAACCATATCAGG + Intergenic
925932034 2:8715890-8715912 GAACACAGCCAAACCATATCAGG - Intergenic
926330675 2:11822707-11822729 GGACACAGCCAAACCATATCAGG + Intronic
926339614 2:11894324-11894346 GGACACAGCCAAACCATATCAGG - Intergenic
926346172 2:11947612-11947634 GGACACAGTCAAACCATATCAGG + Intergenic
926409920 2:12592077-12592099 GCACACAGCCAGACCATATCAGG + Intergenic
926415362 2:12644184-12644206 GGACACAGCCAATCCATATCGGG + Intergenic
926446967 2:12955083-12955105 GGACACAGCCAAACTATATCAGG - Intergenic
926529982 2:14032402-14032424 GGACACAGCCAAACCATATGAGG - Intergenic
926638431 2:15208415-15208437 GGACATAGCCAAACCATATCAGG + Intronic
926739296 2:16097771-16097793 GGAAACAGCAAAACCATATCAGG + Intergenic
926744090 2:16136276-16136298 AGGCACAGCCAAACCATATCAGG - Intergenic
926752912 2:16212612-16212634 GGGCACAGCCAAACCATATCAGG + Intergenic
926865228 2:17349055-17349077 AGACACAGCCAAACCATATCAGG + Intergenic
926926374 2:17992659-17992681 ATACACAGCCAAACCGTATCAGG - Intronic
926951978 2:18252974-18252996 GGACACAGCCAAACCATATCAGG - Intronic
926956451 2:18306494-18306516 GGACACAGCCAAACCATATCAGG - Intronic
927072554 2:19545879-19545901 GGACACAGCCAAACTATATCAGG + Intergenic
927113658 2:19882004-19882026 GGACACAGCCTAACCATATCAGG - Intergenic
927127196 2:20022667-20022689 GGACACAGCCAAACCATATCAGG + Intergenic
927237144 2:20884783-20884805 GGACACAGCCAAATCATATCAGG - Intergenic
927749338 2:25653136-25653158 GGACACAGCCAAACCGTATCAGG - Intronic
928453534 2:31399570-31399592 GGACACAGCCAAACCAAATTAGG - Intronic
928768090 2:34671572-34671594 GGGCACAGTCAAACCATATCAGG + Intergenic
928853681 2:35780142-35780164 GGACACAACCAAACCATATCAGG - Intergenic
928862331 2:35874319-35874341 GAACACAGCCAAACCATATCAGG + Intergenic
928898885 2:36296536-36296558 ACACAGAGCCAAACTATATCAGG + Intergenic
929115880 2:38443656-38443678 GGAGACAGCCAAACCATATCAGG - Intergenic
929337253 2:40763906-40763928 GGACACAGCCAAACCATATTAGG + Intergenic
929444053 2:41989043-41989065 GGACACAGCCAAACCCTATCAGG + Intergenic
930063729 2:47311621-47311643 GGACACAGCCAAACCATATCAGG - Intergenic
930306752 2:49684560-49684582 AGACAAAGCCAAACCATATCAGG - Intergenic
930389741 2:50745905-50745927 GGACATAGCTAAACCATATCAGG + Intronic
930466366 2:51755394-51755416 GCACAGATCCAAACTGTATCTGG - Intergenic
930481242 2:51951218-51951240 GGAGAGAGTCAAACTATATCAGG + Intergenic
930584137 2:53249993-53250015 GGACACAGCCAAATCATATCAGG - Intergenic
930766698 2:55092027-55092049 GGACACAGCCAAACCATGCCAGG + Intronic
930939340 2:56995956-56995978 GGACACAGCCAAACCATATCGGG - Intergenic
931025514 2:58109767-58109789 AGACACAGCCAAACCATTTCAGG + Intronic
931289822 2:60862502-60862524 GGCGACATCCAAACTATATCAGG + Intergenic
931452251 2:62378143-62378165 ACACAGAGCCAAACTATATCAGG - Intergenic
931644412 2:64408524-64408546 GGATACAGCCAAACCATATCAGG - Intergenic
931749476 2:65317990-65318012 GGACACAGCCAAACCATATCAGG - Intronic
931803485 2:65781040-65781062 GGACACAGCCAAACCATATCAGG + Intergenic
932102503 2:68913507-68913529 GGACACAGTCAAACCCTATCAGG + Intergenic
932440239 2:71730232-71730254 GGACACAGCCAAACCATGTCAGG + Intergenic
932440880 2:71734105-71734127 GGACACAGCCAAACCATATCAGG + Intergenic
932894182 2:75622761-75622783 GGATACAGCCAAACAGTCTTTGG + Intergenic
932987773 2:76747503-76747525 GGACACAGACAAACCATACCAGG + Intergenic
933031784 2:77337405-77337427 AGACACAGTCAAACCATATCAGG - Intronic
933051814 2:77610766-77610788 GGACACAGCCAAATCATATCAGG + Intergenic
933251277 2:80031616-80031638 GGACACGGCCAAACTATATCAGG + Intronic
933287183 2:80397391-80397413 GGAAACAGCCAAACCATATCAGG - Intronic
933504092 2:83155835-83155857 GGACATAGCCAAACCATATCAGG - Intergenic
933520089 2:83360805-83360827 GGACACAGCCAAACCATATCAGG - Intergenic
933651499 2:84853582-84853604 GGACACAGCCAAACCATATCAGG + Intronic
933903348 2:86865091-86865113 GGACTCAACCAAACTGTAAGGGG + Intergenic
934489282 2:94748242-94748264 ACACACATCCAAACTATATCAGG + Intergenic
934702383 2:96452624-96452646 GGACACAGCCAAACCACATCAGG - Intergenic
934955408 2:98613680-98613702 GGACACAGCCAAACAATATCAGG + Intronic
935258974 2:101338380-101338402 ACACACAGCCAAACCATATCAGG - Intergenic
935322070 2:101898734-101898756 GGACACAGCCAAACTGTATCAGG + Intergenic
935323197 2:101908215-101908237 GGACACAGCCAAACCGTATCAGG + Intergenic
935436812 2:103044523-103044545 GGACACAGCCAAACCATATCAGG - Intergenic
935777167 2:106483868-106483890 GGACTCAACCAAACTGTAAGGGG - Intergenic
936244044 2:110811115-110811137 GAACACAGCCAAAGCGTATCAGG + Intronic
936256106 2:110913979-110914001 GGGGACATCCAAACTATATCAGG + Intronic
936257377 2:110928676-110928698 GGACACAGCCAAACAATATCAGG - Intronic
936270734 2:111046744-111046766 GGATACAACCAAACCATATCAGG + Intronic
936472223 2:112809517-112809539 ACACAGAGCTAAACTGTATCAGG - Intergenic
936924594 2:117723438-117723460 AGACACAGCCAAACCATATCAGG + Intergenic
937240660 2:120460297-120460319 ACACAGATCCAAACTGTATCAGG + Intergenic
937730483 2:125223798-125223820 GGACACAGCCAAACCATATCAGG + Intergenic
938214924 2:129503452-129503474 GGACCCAGCTAATCTGTACCTGG - Intergenic
938617425 2:133013653-133013675 GAATACAGCCAAACCATATCAGG + Intronic
938811757 2:134860394-134860416 GGACACAGCCCACATGTGTCTGG - Intronic
939156060 2:138525382-138525404 ACACAGAGCCAAACTGTATCAGG + Intronic
939174022 2:138729143-138729165 GGACACAGCCAAACCGTATCAGG - Intronic
939355382 2:141094896-141094918 GGACACATTCAAACCGTAACAGG - Intronic
939423214 2:142000871-142000893 GGACACAGCCAAACCATATCAGG - Intronic
939480217 2:142738927-142738949 AGACAAAGCCAAACAATATCAGG + Intergenic
939525042 2:143282642-143282664 GGACACAGCCAAACCATATCAGG + Intronic
939749204 2:146020161-146020183 GGACACAGCCAAACCATATCAGG + Intergenic
939758156 2:146138838-146138860 GGACACAGCAAAACCTTATCAGG + Intergenic
939762261 2:146197870-146197892 GGACACAGCTAAACCGTATCAGG - Intergenic
939847947 2:147270145-147270167 GGACACAGCCAAACCATATCAGG + Intergenic
940087465 2:149877026-149877048 GGACACAGCCAAACTATATCAGG - Intergenic
940161186 2:150715229-150715251 GGACACAGCCAAACCATATCAGG + Intergenic
940168269 2:150799220-150799242 GGACACATTCAAACTATAGCAGG - Intergenic
940392976 2:153154114-153154136 GGACACAGCCAAACCATATCAGG - Intergenic
940489927 2:154346371-154346393 GGACACAGCCAAACTGTATCAGG - Intronic
940550775 2:155152932-155152954 GGACACAGCCAAACCATATGAGG + Intergenic
940699353 2:157022516-157022538 GGACACAGCCAAACCATATCAGG - Intergenic
941197107 2:162466559-162466581 GAACACAACCAAACCATATCAGG + Intronic
941260526 2:163291469-163291491 GGACACAGCCAAAACATAACAGG - Intergenic
941414805 2:165206668-165206690 GGACACAGCCAAACCATATCAGG - Intergenic
941526913 2:166617982-166618004 GGACAGAGCCAAACCATATCAGG - Intergenic
941560124 2:167034816-167034838 GGACACAGCCAAACCATATCAGG - Intronic
941578572 2:167267364-167267386 ACACAGAGCCAAACCGTATCGGG - Intergenic
941837797 2:170045375-170045397 GGAGACAATCAGACTGTATCAGG + Intronic
942614556 2:177776811-177776833 GGACACAGCCAAACCATGTCAGG - Intronic
942640723 2:178058260-178058282 GGACACAGCCAAACCATATCAGG - Intronic
942749325 2:179269807-179269829 ACACAGAGCCAAACTATATCAGG + Intergenic
943112643 2:183624939-183624961 GGACACAACGAAACCATATCAGG - Intergenic
943142577 2:184001037-184001059 GGACACAGACAAACTGTGTCCGG - Intergenic
943205467 2:184887820-184887842 GGACACAGCCAAACCATATCAGG + Intronic
943262982 2:185689316-185689338 GGAATCAGCAAAATTGTATCTGG + Intergenic
943371530 2:187022747-187022769 ACACGGAGCCAAACTGTATCAGG + Intergenic
943386554 2:187209427-187209449 GGACACAGCCAAACCATATCAGG - Intergenic
943543446 2:189245138-189245160 GGACACAGCCAAACCATATCAGG + Intergenic
943576852 2:189640094-189640116 GGACACAACCAAACCATATCAGG + Intergenic
943720580 2:191199660-191199682 GGACACAGCTGAACCATATCAGG - Intergenic
943744743 2:191450266-191450288 GGACACAGCCAAACCATATCAGG - Intergenic
943749750 2:191499215-191499237 ACACACAGCCAAACCATATCAGG - Intergenic
943859586 2:192843852-192843874 GGACACAACCAAACCATACCAGG + Intergenic
944041819 2:195364699-195364721 AGACACAGCCAAACCATATCAGG - Intergenic
944272375 2:197797600-197797622 GGGCACATCCAAACCATATCAGG + Intergenic
944289620 2:197990728-197990750 GGACACAGCCAAACCATATCAGG + Intronic
944467600 2:200018741-200018763 GGATACAGCCAAACCATATCAGG + Intergenic
944937795 2:204587713-204587735 GGACACAGCCAAATCATATCAGG - Intronic
945414025 2:209548597-209548619 GGACACAGCCAAACTGTACCAGG - Intronic
946281946 2:218672102-218672124 GGACACATCCGAACTGCCTCAGG - Exonic
946452041 2:219788625-219788647 GGACACAGCCAAACCACATCAGG - Intergenic
946490713 2:220146468-220146490 ACACAGAGCCAAACCGTATCAGG - Intergenic
946628951 2:221645442-221645464 GGACACAGCCAAATCATATCAGG + Intergenic
946642449 2:221799278-221799300 ACACAGAGCCAAACCGTATCAGG - Intergenic
946737667 2:222770754-222770776 GGACACAGGCAAACCATATCAGG + Intergenic
946760736 2:222990629-222990651 GGAGACAGCCAAACCATATTGGG + Intergenic
946778782 2:223171590-223171612 GGACACAGCTAAACCGTATCAGG + Intronic
946879987 2:224167831-224167853 ACACAGAGCCAAACTATATCAGG - Intergenic
946900486 2:224367501-224367523 GGACACAGCCAAGCCACATCAGG - Intergenic
946900896 2:224370242-224370264 GGATACAGCCAAACTATATCAGG - Intergenic
947008674 2:225540610-225540632 GGACACAGCCAAATCATATCAGG + Intronic
947118359 2:226795234-226795256 GGAGCCAGCCAAACTGTGTGGGG - Exonic
947254964 2:228152844-228152866 GGACACAGCCAAACCATATTAGG - Intronic
947261137 2:228223782-228223804 GGACACAGCCAAACCATATCAGG - Intergenic
947289981 2:228562144-228562166 GGACACAGCCAAACCGTATCAGG + Intergenic
947838436 2:233191416-233191438 GGACACAGCCAAACCATATCAGG + Intronic
947889334 2:233603155-233603177 GGACACAGCCAAACCATATCAGG + Intergenic
947963214 2:234257516-234257538 GGACACAGCCAAACCATATCGGG - Intergenic
948008965 2:234635553-234635575 GGACACAGCCAAACCATATCAGG - Intergenic
948064798 2:235069522-235069544 GGACACAGACAAACCATATCAGG + Intergenic
948286208 2:236787415-236787437 GGACACAGCCAAACCATATCAGG - Intergenic
948914770 2:241028893-241028915 GGACACAGCCAAAAATAATCGGG - Intronic
1168944219 20:1738301-1738323 GGACACAGCTAAACCATATCAGG - Intergenic
1168957905 20:1847749-1847771 GGACACACCCAAACCATATCAGG + Intergenic
1169495709 20:6113008-6113030 AGACACATCCAAACCATATCAGG - Intronic
1169579313 20:7001337-7001359 AGACACAGCCAAACCATATCAGG - Intergenic
1169590836 20:7140625-7140647 GGACATAGCCAAACCATATCAGG - Intergenic
1169594087 20:7178000-7178022 GGACACAGCCAAACCATATCAGG + Intergenic
1169619192 20:7486085-7486107 GGACACAGACAAACCATATCAGG + Intergenic
1170015380 20:11775534-11775556 GGCAACACCCAAACTGTATCAGG - Intergenic
1170065422 20:12304853-12304875 GGACACAGCGAAACCATATCAGG + Intergenic
1170715034 20:18824017-18824039 GGACACAGCCAAACCATATCAGG - Intronic
1170751829 20:19155187-19155209 GGACACAGCCAAAACATATCAGG + Intergenic
1170784556 20:19456240-19456262 AGACATAGCCAAACCATATCTGG - Intronic
1170817713 20:19728960-19728982 GGACACAGCCAAAACATATCAGG - Intergenic
1171118856 20:22550750-22550772 GGACACAGCCAAACCATATCAGG + Intergenic
1171540538 20:25949866-25949888 GGACACAGCCAAACCCTAACAGG - Intergenic
1171800539 20:29610465-29610487 GGACACAGCAAAACCCTAACAGG + Intergenic
1171843566 20:30246241-30246263 GGACACAGCAAAACCCTAACAGG - Intergenic
1172579046 20:36032206-36032228 GGACACAGCCAAATCGTATCAGG - Intergenic
1172911886 20:38415643-38415665 GGACACAGCCAAACCACATCAGG - Intergenic
1173412601 20:42827589-42827611 GGACACAGCCAAACCACATAAGG - Intronic
1173419773 20:42890777-42890799 GGACACAGCCAAACTGTATCAGG - Intronic
1173441971 20:43085804-43085826 GAATACAGCCAAACCATATCAGG + Intronic
1173941487 20:46914741-46914763 GGACGCAGCCAAACCGTATCAGG + Intronic
1173960214 20:47065218-47065240 GGACACAGCCAAACTATATCAGG + Intronic
1174409910 20:50328536-50328558 GGACACAGCCAAATCATATCAGG + Intergenic
1174960701 20:55154080-55154102 GGACATAGCCAAACCATATCAGG - Intergenic
1175060325 20:56236339-56236361 GGACACAGCCAAACCATATCAGG - Intergenic
1175275300 20:57764486-57764508 GGACACAGCCAAACCATATCAGG + Intergenic
1175531957 20:59679929-59679951 GGACACAGCCAAACTGTATCAGG + Intronic
1175543079 20:59760349-59760371 GGACACAGCCAAACCATATCGGG - Intronic
1175563279 20:59951233-59951255 GGGCACAGCCAAACTGTACCAGG + Intergenic
1175603253 20:60292097-60292119 GCACAGAGCCAAACCATATCAGG - Intergenic
1175745432 20:61453736-61453758 GAACACAGCCAAACCATATCAGG - Intronic
1175770040 20:61617791-61617813 GGAGACAGCCAAACCCTATCAGG - Intronic
1175792966 20:61753967-61753989 GGACACAGTCCTACTGCATCAGG - Intronic
1175849621 20:62082490-62082512 GGACACAGCCAGACCATATCAGG - Intergenic
1175861616 20:62153318-62153340 GGACACAGACAGACCCTATCAGG + Intronic
1176013421 20:62913272-62913294 GGACACAGCTCAACTCAATCAGG + Intronic
1176657851 21:9603809-9603831 GGGCACAGCCAATCCATATCGGG + Intergenic
1176877791 21:14150294-14150316 ACAAACAGCCAAACTATATCAGG + Intronic
1176951144 21:15047714-15047736 AGACACAGCCAAACCATATCAGG + Intronic
1176958079 21:15129088-15129110 GGACACAGCCAAACCATATCAGG + Intergenic
1177145918 21:17406885-17406907 GGACACAACCAAACCATATCAGG - Intergenic
1177323091 21:19546979-19547001 GGACACAGCCAAACCATATCAGG - Intergenic
1177339921 21:19785121-19785143 GGACACAGCCAAACTATATCAGG + Intergenic
1177379799 21:20325710-20325732 GGAAACAGCAAAATTGTATTAGG + Intergenic
1177408172 21:20697796-20697818 GGAAATAGCCAAAGCGTATCAGG - Intergenic
1177459306 21:21389416-21389438 GGACACAGCTAAACCATATTGGG + Intronic
1177471996 21:21571263-21571285 GGACAGAGCCAAACCATATCAGG - Intergenic
1177484866 21:21744804-21744826 GGACACAGTCAAACCATATCAGG - Intergenic
1177487631 21:21779202-21779224 GGACATAGCCAAACTATATCAGG + Intergenic
1177489600 21:21805273-21805295 GGACACAGCCAAACCATATCAGG - Intergenic
1177587417 21:23116325-23116347 GGACACAGCCAAAAAATATCAGG + Intergenic
1177719268 21:24883562-24883584 GGACACAGCCAAACCATATCAGG - Intergenic
1177767182 21:25472547-25472569 ACCCAGAGCCAAACTGTATCAGG - Intergenic
1177854055 21:26382301-26382323 GGACACAGTCAAACCATATCAGG - Intergenic
1177890993 21:26804037-26804059 GCACAGAGCCAAACCATATCAGG - Intergenic
1177949713 21:27519518-27519540 CAACACAGTCAATCTGTATCTGG + Intergenic
1177952334 21:27553495-27553517 GAACACAGCCAAACCATATCAGG + Intergenic
1178020886 21:28406977-28406999 GGACACAGCCAAACCATATCAGG + Intergenic
1178046094 21:28696266-28696288 GGACACAGCCAAACCACAACCGG + Intergenic
1178056060 21:28799461-28799483 GGACACAGCCAAACCCTATCAGG + Intergenic
1178079913 21:29052608-29052630 GGACACAGCCAAACCATATCAGG + Intronic
1178097352 21:29230310-29230332 GCACAGAGCCAAACCATATCAGG + Intronic
1178111483 21:29374225-29374247 GGACACAGCCAAACCATATCAGG + Intronic
1178180635 21:30157129-30157151 GGACACAGCCAAACCATATCAGG + Intergenic
1178225351 21:30710858-30710880 GGACACAGCCAAACTATATCAGG + Intergenic
1178254966 21:31044049-31044071 ACACAGAGCCAAACTGTATCAGG - Intergenic
1178266595 21:31148206-31148228 GGACACAGCCAAACCATATCAGG - Intronic
1178336222 21:31745842-31745864 GGACACAGCCAAACCTTATTGGG - Intergenic
1178371500 21:32030875-32030897 ACAAACATCCAAACTGTATCAGG - Intronic
1178429323 21:32505155-32505177 GGACACAGCCAAACCATATTGGG + Intronic
1178432726 21:32530813-32530835 GGACACAGCCAAACCGTAACAGG - Intergenic
1178461572 21:32807149-32807171 GGACACAGCCAAACCATATCAGG + Intronic
1178475921 21:32937048-32937070 GGACACAGCCAAACCATATCAGG - Intergenic
1178514397 21:33234531-33234553 AGACACAGCCATACTTTACCAGG + Intronic
1178911117 21:36674498-36674520 GGACACAGCCAAACCATATCAGG + Intergenic
1179049004 21:37872715-37872737 GGACACAGTCAAACCATATCAGG - Intronic
1179161085 21:38900037-38900059 GGACACAGCCAGACCATATCAGG - Intergenic
1179231382 21:39506759-39506781 GTACACAGCCAAACCATATCAGG + Intronic
1179235473 21:39541601-39541623 GGACACAACCAAACCATATTAGG + Intergenic
1179250993 21:39671238-39671260 GGACACATTCAAACTGTAGCAGG + Exonic
1179310564 21:40192238-40192260 GGACACAGCCAAACCATATCAGG - Intronic
1179473051 21:41624719-41624741 GGACAGAGCCAAACCATATCAGG + Intergenic
1179488174 21:41724121-41724143 GAACACAGCCAGACCCTATCAGG + Intergenic
1179598214 21:42457686-42457708 GGACACAGCCAAACCATATTAGG + Intergenic
1180255939 21:46627558-46627580 GGACACAGCCAAACCATATCAGG + Intergenic
1180260573 21:46666167-46666189 GGACTCAGCCAAATTATATCAGG - Intergenic
1181074784 22:20368349-20368371 TCACAGACCCAAACTGTATCAGG + Intronic
1181183578 22:21084987-21085009 GGACAGAGCCAAACCATATCAGG + Intergenic
1182083670 22:27546488-27546510 GGACACAGCAAAACCATATCAGG + Intergenic
1182246683 22:28963675-28963697 GGAGACAGCCACTATGTATCAGG + Intronic
1182940444 22:34271445-34271467 GGTCACAGCCAAACCATATCAGG + Intergenic
1183002547 22:34873655-34873677 GGACACAGCCAAACTATATCAGG + Intergenic
1183312508 22:37118334-37118356 GGACACAGCCAAACCACATCAGG + Intergenic
1184792230 22:46707364-46707386 GGACACAGCCCAGCTGTTCCCGG + Intronic
1184929422 22:47670036-47670058 GGACACAGCCAACCCATATCAGG + Intergenic
1185133361 22:49053260-49053282 GGACACGGCCAAACCATATCAGG + Intergenic
949221472 3:1639216-1639238 GGACACAGCCAAACCGTATCAGG - Intergenic
949264394 3:2139878-2139900 GTACACAGACAAACCGTATCAGG - Intronic
949354067 3:3158827-3158849 GGACACGGCCAAACCCTATCAGG - Intronic
949424288 3:3899851-3899873 GGGCACAGCCAAACCATATCAGG - Intronic
949424898 3:3906433-3906455 GGCCACAGCCAAACCATGTCAGG - Intronic
949474093 3:4426103-4426125 GGACACAGCCAAACCATATCAGG + Intronic
949641375 3:6038735-6038757 GGACACAGCAAAACCATATCAGG + Intergenic
949760012 3:7459756-7459778 GGAAACAGCCAAACCGTATCAGG + Intronic
949818507 3:8089272-8089294 GGACACAGCCAAACTGTATCAGG - Intergenic
949935644 3:9113598-9113620 GGACACAGCCAAACCATATCAGG - Intronic
950071599 3:10157115-10157137 GGACACAGCCAAACCGTATCAGG + Intergenic
950310897 3:11956876-11956898 GAACATATCCAAACTATATCAGG - Intergenic
950787520 3:15448879-15448901 GGACACAGCCAAACCAGATCAGG - Intronic
950806263 3:15605461-15605483 GGACATAACCAAACCATATCAGG + Intronic
950833396 3:15897218-15897240 GGGCACAGCTAAGCTGAATCTGG + Intergenic
950874037 3:16254055-16254077 GGACTCAGCCACAATGTATCAGG - Intergenic
951054935 3:18136506-18136528 GGGCACAGCCAAACCATATCAGG + Intronic
951192289 3:19785175-19785197 GGACACAGCCAAACCATATCAGG - Intergenic
951435196 3:22654649-22654671 GGACACAGTGAAACTATATCAGG + Intergenic
951495226 3:23317803-23317825 GGACACAGCCAAACCGTATCAGG + Intronic
951737562 3:25884650-25884672 GCACACAGCCAAACCATATCAGG + Intergenic
951924679 3:27895797-27895819 GGACACAGCCAAACCCTATCAGG + Intergenic
952020069 3:29008138-29008160 GGACACAGCCAAAGCATGTCAGG + Intergenic
952194920 3:31065130-31065152 GAACACAGCCAAACCATATTAGG + Intergenic
952396837 3:32928751-32928773 GAACATAGCCAAACCATATCAGG - Intergenic
952606067 3:35147652-35147674 ACACAGAGCCAAACCGTATCAGG + Intergenic
952739549 3:36722512-36722534 GGACACAGCCAAACCATATCAGG - Intronic
952939856 3:38434229-38434251 GGACACAGCCAAACCATATCAGG + Intergenic
953073247 3:39544747-39544769 GGACACAGCCAAAGCATATAAGG - Intergenic
953268164 3:41413302-41413324 GGACACAGCCAAGCCATATCAGG + Intronic
953384287 3:42497578-42497600 CGACACAGCCAAACCGTATCAGG - Intronic
953943060 3:47119451-47119473 GGAAACAGCCAAACCATATCAGG - Intronic
954901381 3:54022878-54022900 ACACACAGCCAAACCATATCAGG + Intergenic
954955267 3:54513116-54513138 GGACACAGCCAAACCATATCAGG + Intronic
955128855 3:56143328-56143350 GGACACAACCAAACCATATCAGG - Intronic
955154373 3:56402170-56402192 GGACAGAGCCAAACCATATCAGG + Intronic
955441235 3:58957019-58957041 GGACACAGCCAAACCATATCAGG + Intronic
955555077 3:60128171-60128193 GAACACAGCCAAACCATATCAGG - Intronic
955808133 3:62758041-62758063 GGACAAAGCCAAACCATATCAGG + Intronic
955900383 3:63747448-63747470 GGACACAGCCAAACCATATCAGG + Intergenic
956181528 3:66522268-66522290 GGACACAGCCAAACCATATCAGG + Intergenic
956213638 3:66826524-66826546 GGGCACAGCCAAACCATATCAGG - Intergenic
956263640 3:67373488-67373510 GGACACAGCCAAACCATATCAGG + Intronic
956306247 3:67830415-67830437 GGACACACACAAACCATATCAGG - Intergenic
956360721 3:68443776-68443798 GGACACAGCCAAACCATATCAGG + Intronic
956406664 3:68934847-68934869 GGACACAGTCATACTGGATTCGG - Intergenic
956425715 3:69132633-69132655 GGACACAGCCAAACCATATCAGG - Intergenic
956534894 3:70265165-70265187 GGACACAGCCAAACCATATCAGG + Intergenic
956739861 3:72267302-72267324 GGACACAGCCAAACCATATCAGG + Intergenic
956811444 3:72867601-72867623 GGACACAGCCAAACCGTATCAGG + Intergenic
956940447 3:74154327-74154349 GGACACAGCCAAACTATATCAGG + Intergenic
957046915 3:75382916-75382938 GGACACAGCCAAACCATATCAGG - Intergenic
957148884 3:76458951-76458973 AGACACAGCCAAACCATATCAGG + Intronic
957232472 3:77537973-77537995 GGACACAGCCAAACCATATCAGG + Intronic
957336187 3:78831991-78832013 GGACACAGCCAAACCATATCAGG + Intronic
957346189 3:78964186-78964208 GGACACAGCCATATTGGATTAGG + Intronic
957520664 3:81314182-81314204 GGACACGGCCAAACCATATCAGG + Intergenic
957741812 3:84280092-84280114 GGACACAGCCAAACAATATCAGG + Intergenic
957757316 3:84508142-84508164 GGACACAGTCAAACCTTATCAGG - Intergenic
957949365 3:87105985-87106007 GGACACAGGCAGACAATATCAGG - Intergenic
957993588 3:87659345-87659367 AGACACAGCCAAACCATATCAGG - Intergenic
958052588 3:88367097-88367119 GGACACAGCCAAACCATATCAGG + Intergenic
958090340 3:88869444-88869466 GGACACAGCTAAACCATATAAGG + Intergenic
958196094 3:90244348-90244370 TGACACAGCCAAACCGTATCAGG - Intergenic
958196127 3:90244586-90244608 GGACACAGCCAAACCATATCAGG - Intergenic
958419286 3:93912991-93913013 GGACACAGCTAAACCATATCAGG - Intronic
958419317 3:93913231-93913253 GGACACAGCCAAACTATATCAGG - Intronic
958595256 3:96214720-96214742 GGACACAGTCAAATCATATCAGG - Intergenic
958891126 3:99783912-99783934 CCACAGAGCCAAACTATATCAGG + Intronic
959092374 3:101917734-101917756 GGACACAGCTAAACCATATCAGG - Intergenic
959228860 3:103620686-103620708 GGACACAGCCAAACCATATAAGG + Intergenic
959264212 3:104117473-104117495 AGAGACAGCCAAACCTTATCAGG - Intergenic
959306308 3:104670784-104670806 GGACACAGCCAAACCATATCAGG + Intergenic
959403830 3:105936389-105936411 GGAAACAGCCAAACCACATCAGG + Intergenic
959453413 3:106531144-106531166 GGACACAGCCAAACCATATCAGG - Intergenic
959484431 3:106910390-106910412 GGACACAGCCAAACCATGTCAGG + Intergenic
959524422 3:107360776-107360798 GGACACAGCCAAATCACATCAGG - Intergenic
959593248 3:108101977-108101999 GGACACAGCCAAACCCTATCAGG + Intergenic
959624140 3:108431278-108431300 GGACACAGCCAAACCTTATCAGG - Intronic
959787908 3:110322565-110322587 GGACACAGCCAAACCATATCAGG + Intergenic
959808837 3:110592509-110592531 GGACACAGCCAAACCATATCAGG - Intergenic
959873288 3:111352718-111352740 GAACACAGCCAAACCACATCAGG - Intronic
960197621 3:114789066-114789088 GGACAGAGCCAAACCATATCAGG + Intronic
960257574 3:115527339-115527361 GGACACAGCCAAACCATATCAGG - Intergenic
960424880 3:117493843-117493865 GGACACAGCCAAACCATTTCAGG + Intergenic
960463292 3:117963963-117963985 ATACAAAGCCAAACGGTATCAGG - Intergenic
960564565 3:119119511-119119533 GGACACAACCAAACGATATCAGG + Intronic
960793839 3:121463092-121463114 AGACATAGCCAAACCTTATCAGG - Intronic
961342816 3:126240156-126240178 GGACACAGCCAAACCATATCAGG + Intergenic
961495937 3:127291426-127291448 GGACACAGCAAAACCGTATCAGG - Intergenic
961878983 3:130046978-130047000 GGACACAGCCAAACCATATCAGG - Intergenic
961932734 3:130550787-130550809 TGACACAGCCAAACCATATCAGG + Intergenic
962182910 3:133227116-133227138 GGACATGGCCAAACTATATCAGG + Intronic
962488725 3:135869622-135869644 GAACACAGCCAAACCATATCAGG + Intergenic
962769798 3:138601716-138601738 AGACACAGCCAAACCATATCAGG - Intergenic
962853563 3:139325603-139325625 GGACAGAGCCAAACCATGTCAGG + Intronic
963097939 3:141565417-141565439 GGACACAGCCAAACCACATCAGG - Intronic
963470749 3:145738892-145738914 GGACAGATCCAAACCATATCAGG - Intergenic
963475297 3:145796050-145796072 GGACACAGCCAAACCATATCAGG + Intergenic
963548155 3:146686709-146686731 AGACATAGCCAAACTGTATAAGG + Intergenic
963581988 3:147136601-147136623 GGACACAGCCAAACAATATCAGG + Intergenic
963627224 3:147688894-147688916 GGACACAGCCAAACCATACTAGG + Intergenic
964449759 3:156800654-156800676 GGACACAGCCAAACCATTTCAGG + Intergenic
964768989 3:160204724-160204746 GGACACAGCCAAAACATATCCGG + Intergenic
964792851 3:160469363-160469385 AGACACAGCAAAACCATATCAGG - Intronic
964944316 3:162201055-162201077 GGACACAGCCAAACCATATCAGG + Intergenic
965127384 3:164648503-164648525 AGACACAGCCAAACCATATCAGG - Intergenic
965229986 3:166038257-166038279 GGACAGAGCCAAACAATATAAGG - Intergenic
965259446 3:166461990-166462012 GGACTAACCCAGACTGTATCAGG - Intergenic
965363738 3:167773146-167773168 GGACACATCCTAACTATACCAGG + Intronic
965637445 3:170797922-170797944 GGACACAGCCAAACCATATTAGG + Intronic
965957290 3:174386548-174386570 GGACACAGCCAAACCATATCAGG + Intergenic
966002820 3:174971236-174971258 GGAGACAGCCAAACCATATTGGG + Intronic
966090163 3:176124577-176124599 GGACATAGCCAAACAATATCAGG - Intergenic
966100228 3:176260007-176260029 GGACACAGCCAAACCATATCAGG - Intergenic
966278701 3:178205763-178205785 GAACACAGCCAAACCATATCAGG + Intergenic
966320534 3:178696307-178696329 GGACACAGCCAAACCATATCAGG + Intronic
966414592 3:179675918-179675940 GGACACAGCCAAACCATATCAGG - Intronic
966512336 3:180777675-180777697 GGACACAGTCAAACTATATTAGG + Intronic
967055908 3:185827986-185828008 GGACACAGCCGAACCCTATCAGG + Intergenic
967219937 3:187240012-187240034 GGACATAGCCAAACCATATCAGG - Intronic
967315521 3:188149017-188149039 GGACACAGCCAAACCATATCAGG + Intergenic
967407444 3:189133396-189133418 ACACACAGCCAAACCATATCAGG - Intronic
967810785 3:193759194-193759216 ACACAGAGCCAAACCGTATCTGG + Intergenic
968403130 4:316072-316094 GGACACAGCCAAACCAAGTCAGG + Intergenic
968907327 4:3460623-3460645 GGACACAGTCGAACTGTATCAGG + Intergenic
968991210 4:3914025-3914047 GGACACAGCCAAACCATATCAGG - Intergenic
969037386 4:4265688-4265710 GGACACAGCCAAGCCATATCAGG - Intergenic
969050522 4:4369735-4369757 GGGCACAGCCATATTGGATCAGG + Intronic
969268284 4:6080439-6080461 GGACACAGCCAAACCATATCAGG - Intronic
969322718 4:6422695-6422717 GGACACAGTCATATTGGATCAGG + Intronic
969358470 4:6645942-6645964 GGACACAGCCAAACCATATCAGG - Intergenic
969423407 4:7110008-7110030 GGACATGGCCAAACCATATCAGG - Intergenic
969441498 4:7219772-7219794 GGACACAGCCAAACCATATCAGG + Intronic
969683223 4:8654863-8654885 GGACACAGCCAAACCATATCAGG + Intergenic
969824143 4:9743506-9743528 GGACACAGCCAAACCATATCAGG + Intergenic
969896891 4:10313730-10313752 GGGGATATCCAAACTGTATCAGG - Intergenic
969950608 4:10831458-10831480 GGACCCAGCCAAACCATATCAGG - Intergenic
970118883 4:12730503-12730525 GGACACAGCCAAACCAGATTAGG + Intergenic
970174846 4:13329233-13329255 GGACACAGCCAAATCACATCAGG + Intergenic
970233280 4:13932992-13933014 GGACACAATCAAACCATATCAGG + Intergenic
970303469 4:14705779-14705801 GAACACAGCCAAACCATATCAGG - Intergenic
970340647 4:15103304-15103326 GGACACAGCCAAACCATATCAGG - Intergenic
970398811 4:15698161-15698183 GGACGCAGCCATACCATATCAGG - Intronic
970547964 4:17148887-17148909 GGACAAAACCAAACCATATCAGG - Intergenic
970578547 4:17451622-17451644 GGACCCAGCAATTCTGTATCAGG + Intergenic
970581662 4:17478905-17478927 GGACACAGCCAAACCAAATCAGG + Intronic
970670721 4:18393934-18393956 GGACACAGCCAAACCATATCAGG - Intergenic
970700405 4:18730245-18730267 GGACACAGTCAAACTGTGTCTGG + Intergenic
970709907 4:18849709-18849731 GGATACAGCCAAACCACATCAGG - Intergenic
970746745 4:19307477-19307499 GGACCCAGTCAAACCATATCAGG - Intergenic
970830591 4:20335189-20335211 GGACACAGCCAAACCATATCAGG + Intronic
970856055 4:20650578-20650600 AGACACAGCCAAACCATATCAGG + Intergenic
971051136 4:22864004-22864026 GGACACAGCCAAACCATATCAGG - Intergenic
971111283 4:23588908-23588930 GGACACAGCCAAGCCATACCAGG - Intergenic
971262154 4:25066931-25066953 GGACACAGCCAAACCATATCAGG - Intergenic
971561691 4:28085598-28085620 GGACAGAGCCAAACCATACCAGG + Intergenic
971594122 4:28506669-28506691 AGACACAGCCAAATCATATCAGG + Intergenic
971629664 4:28974271-28974293 GGATGCAGCCAAACCATATCAGG + Intergenic
971744695 4:30565225-30565247 GGACACAGCAAAACCATGTCAGG - Intergenic
971801520 4:31299029-31299051 GGACACAGCCAAACCATATCAGG - Intergenic
971867328 4:32189850-32189872 GGATACAGCCAAACCACATCAGG + Intergenic
971875188 4:32299832-32299854 GGACACAGCCAAACCATATTAGG - Intergenic
972129149 4:35808245-35808267 GGACACAGCCAAACCAAATCAGG + Intergenic
972199813 4:36701578-36701600 GGACACAGCCAAACCATATCAGG - Intergenic
972239767 4:37177755-37177777 GGACACAGCCAAACCATATCAGG - Intergenic
972245082 4:37237652-37237674 GGACACAGCCAAACCATATCAGG + Intergenic
972369810 4:38412391-38412413 GGACACAGCCACACTTTCTAGGG - Intergenic
972408335 4:38766970-38766992 GGACACAGCCAAATCATATCGGG - Intergenic
972678136 4:41279936-41279958 GGACACAGCCAACACTTATCAGG + Intergenic
972684595 4:41339582-41339604 GGACACTGCCAAACCATACCAGG + Intergenic
972757148 4:42058865-42058887 GGACACAGTCAAACCATATCAGG + Intronic
972816346 4:42650908-42650930 GGACACAGCCAAACTATATCAGG - Intronic
972841210 4:42932131-42932153 GGACACAGTCAAACCATATCAGG + Intronic
972878583 4:43395919-43395941 GGATACAGCCAAACCATATCAGG + Intergenic
972998807 4:44919070-44919092 GGACACAGCCAAACCATATCAGG - Intergenic
973582361 4:52356968-52356990 AGACACAGTCAAACCTTATCAGG + Intergenic
973607979 4:52606648-52606670 AGACACAGCCAAACCATATCAGG + Intronic
973641803 4:52910661-52910683 GGACACAGCCAAACCATATCAGG - Intronic
973908834 4:55558213-55558235 GGACATAGCCAAACCATATCAGG - Intronic
974013661 4:56629677-56629699 GGACACAACCAAACCATATTGGG + Intergenic
974066808 4:57086326-57086348 GAACACAGCCAAACCATATCAGG + Intronic
974305174 4:60127303-60127325 GGACACAGCCAAATCGTATCGGG + Intergenic
974352871 4:60772842-60772864 GGACATAGCCAAACCATATCAGG + Intergenic
974373414 4:61045811-61045833 GAACACAGCCAAACCATATCAGG + Intergenic
974388584 4:61234470-61234492 GGACACAGCCAAACTATATCAGG + Intronic
974430842 4:61793583-61793605 GGACACAGCCAAACCATGTCAGG + Intronic
974497515 4:62651138-62651160 GGGCACAGCCAAACCATATCAGG + Intergenic
974499268 4:62677794-62677816 GGACACAGCCAAACCATATTAGG - Intergenic
974614872 4:64267795-64267817 GGACACATCCAAACTATATCAGG + Intergenic
974746423 4:66084108-66084130 GGACACAGCCAAACCATATCAGG - Intergenic
974772621 4:66435216-66435238 GGACACAGCCAAAATATATCAGG + Intergenic
974872341 4:67659273-67659295 TGACACAGCCAAACCATCTCAGG - Intronic
974900224 4:67987834-67987856 GGACAGAGCCAAACCATATCAGG - Intergenic
974991016 4:69090699-69090721 GGACACAGATAAACCATATCAGG + Intronic
975026720 4:69557959-69557981 TGACACAGCCAAACCATATCAGG + Intergenic
975200397 4:71581506-71581528 GAACACAGCCAAACCATATTGGG + Intergenic
975540777 4:75509580-75509602 GAACACAGCCAAAGCATATCAGG - Intronic
975632102 4:76414539-76414561 GGACACAGCCAAACCATATCAGG - Intronic
975847383 4:78539113-78539135 GGACACAGCCAAACCATATCAGG + Intronic
976040306 4:80876217-80876239 TGACACAGCCAAACCATATCAGG - Intronic
976150279 4:82084563-82084585 GGACACAGTCAACCCATATCAGG + Intergenic
976366368 4:84237380-84237402 GAACATAGCCAAACCGTATCAGG - Intergenic
976405777 4:84659327-84659349 GAACACAGCCAAACCATATCAGG + Intergenic
976468127 4:85394862-85394884 GGACACATTCAAACTGTAAAAGG + Intergenic
976635287 4:87281310-87281332 GGACACACTCAAACTATATCAGG - Intergenic
976674620 4:87690781-87690803 GGACAGAGCCAAACCATATCAGG - Intergenic
976803798 4:89023005-89023027 GGACACAACTAAGATGTATCTGG + Intronic
976852011 4:89558536-89558558 GGACACAGCCAAACCATATGAGG + Intergenic
976949692 4:90813443-90813465 GGACACAGCCAAACTATATCAGG - Intronic
977006221 4:91571716-91571738 GGACACAGCTAAGCTATATCAGG + Intronic
977464856 4:97371286-97371308 GGACACAGCCAAACTATATCAGG - Intronic
977465028 4:97373165-97373187 GGACATAGCCAAATCATATCAGG + Intronic
977513894 4:97995783-97995805 GGACACAGCAAAACCATGTCTGG - Intronic
977570173 4:98621039-98621061 GGACACAGTCATACTGGATTAGG - Intronic
977579231 4:98706040-98706062 GGACACAGCCAAACCATATCAGG + Intergenic
977996374 4:103501425-103501447 GGACACAGCCAAACCATGTCAGG - Intergenic
978044078 4:104105588-104105610 GGACACAGCAAAACCACATCTGG - Intergenic
978086128 4:104657546-104657568 ACACAGAGCCAAACTATATCAGG - Intergenic
978226078 4:106337259-106337281 GGACATAGTCAAACCATATCAGG - Intronic
978908951 4:114043304-114043326 GGTCACAGCCAAACCATATCAGG + Intergenic
978958230 4:114640900-114640922 GGACACAGCCAAACCATATCAGG + Intronic
978982159 4:114959639-114959661 GGACACAGCCAAACCATATCAGG + Intronic
979139354 4:117152541-117152563 GGACACAGCCATACCATATCAGG + Intergenic
979480177 4:121207830-121207852 GGACACAGCCAAACCATATCAGG - Intronic
979547656 4:121955566-121955588 GGACACAGCCAAACCATATCAGG + Intergenic
979548528 4:121964277-121964299 GGGCACAGCCAAACCATATGAGG + Intergenic
979896028 4:126157842-126157864 GGACATAGCCAAACCATATGAGG + Intergenic
980142798 4:128941208-128941230 GAAGACAGCCAAACCGTATCAGG + Intronic
980673072 4:136035651-136035673 GGACACAGCCAAAGAATATGAGG - Intergenic
980868183 4:138578219-138578241 GGACACAGCCAAACCATATCAGG + Intergenic
981121147 4:141052215-141052237 GGACACAGCCAAACCACACCAGG + Intronic
981124043 4:141085364-141085386 GGACACAACCAAACCATATCAGG + Intronic
981138935 4:141245058-141245080 GGACACAATCAAACCATATCAGG - Intergenic
981194408 4:141901849-141901871 GGACGCAGTCAAACCATATCAGG + Intergenic
981297831 4:143153595-143153617 GGACACAGCCAAACCATGCCTGG - Intergenic
981607934 4:146559705-146559727 GGACACAGCCAAACCATATCAGG + Intergenic
981645649 4:146995821-146995843 AGACACAGCCAAACCATATCAGG - Intergenic
981862752 4:149377891-149377913 GGACACAGCCAAACAATATCAGG - Intergenic
982509630 4:156265304-156265326 GGACACAGTCAAACCATATCAGG - Intergenic
982608945 4:157550081-157550103 GGACACAGCCAAACCATGTAAGG - Intergenic
982753479 4:159190879-159190901 AGATACAGCCAAACCATATCAGG + Intronic
982816909 4:159897248-159897270 GGACACAAACAAACCATATCAGG - Intergenic
982886303 4:160787529-160787551 GGACACAGCCAAACCATATCAGG - Intergenic
983319972 4:166184329-166184351 GGACACAGCCAAACCATATCAGG - Intergenic
983371903 4:166870758-166870780 GGACACAGTCAAACTATATCAGG - Intronic
983396113 4:167197857-167197879 GGACAGATCCAAACTGTGTAAGG + Intronic
983419757 4:167501993-167502015 GGACACAGCCAAACCATATCAGG + Intergenic
983419910 4:167503932-167503954 TGACACAGCCAAACCATATCCGG - Intergenic
983711563 4:170722988-170723010 GGACACAGCCAAACCATATTAGG + Intergenic
983739076 4:171105325-171105347 AGACACAGCCAAACTATAGCAGG - Intergenic
984050768 4:174862142-174862164 GGATACAGCCAAACAATATCAGG + Intronic
984467434 4:180118777-180118799 GGACACAGCCAAACCATATCAGG - Intergenic
984512427 4:180694570-180694592 GGACACAGCCAAACTGTATCAGG + Intergenic
984513896 4:180714511-180714533 GGACACAGCCAAACCATATCAGG - Intergenic
984722638 4:182990244-182990266 GGACACAGTCAAACCATATCAGG - Intergenic
985133173 4:186759297-186759319 GGACACAGCCAAACCATATCAGG + Intergenic
985417559 4:189752278-189752300 GGGCACAGCCAATCCATATCGGG - Intergenic
985864597 5:2504570-2504592 GGACACAGCCAAACCATATCAGG - Intergenic
986021878 5:3812194-3812216 GGACACAGCCAAACCATATCAGG + Intergenic
986081894 5:4403380-4403402 GGACATAACCAAACCATATCAGG + Intergenic
986118163 5:4801278-4801300 GGATACAGCCAAACCATATCAGG - Intergenic
986154715 5:5163312-5163334 GGACACAGCCAAACCAAAGCAGG - Intronic
986211246 5:5674982-5675004 GGACACAGCCAAACCATATCAGG + Intergenic
986240037 5:5952504-5952526 GGACACAGCCAAATCATATCAGG - Intergenic
986376569 5:7137919-7137941 GGACACAGCCAAATCATATCAGG + Intergenic
986396781 5:7338565-7338587 AGACACAGCCAAACCATACCAGG + Intergenic
986449010 5:7848620-7848642 GGACACAGCCAAACCATATCAGG - Intronic
986498495 5:8372530-8372552 GGACACAGCTAAACCATATCAGG + Intergenic
986563170 5:9084368-9084390 GGACACAGCCAAACCATATCAGG - Intronic
986578363 5:9236176-9236198 GGACACAGCCAAACCATATCAGG + Intronic
986668226 5:10121291-10121313 TGACACAGCCAAACCATATCAGG - Intergenic
986860445 5:11921117-11921139 GGACACAGCAAAACCATATCAGG - Intergenic
987069398 5:14321685-14321707 GGTCACAGCCAAACCATATCAGG - Intronic
987133922 5:14883359-14883381 GGACACAGCCAAACCATATCAGG - Intergenic
987252119 5:16110804-16110826 GGACACAGCCAAACCATGTCAGG - Intronic
987467138 5:18285292-18285314 GCACACAGCCAAATCATATCAGG + Intergenic
987766178 5:22234238-22234260 GGACACAGCCAAACCATATCAGG - Intronic
987836930 5:23173831-23173853 AGACAAAGCCAAACGGTATCAGG + Intergenic
988012340 5:25505471-25505493 GAACACAGACAAACTATAGCAGG + Intergenic
988035875 5:25826253-25826275 GAACACAGCAAAACCATATCAGG + Intergenic
988067560 5:26240911-26240933 GGACACAGCCAACCCATATCTGG + Intergenic
988321751 5:29706845-29706867 AGAGACAGACAAACTGGATCAGG + Intergenic
988386562 5:30573643-30573665 ACACAGAGCCAAACTATATCAGG - Intergenic
988388151 5:30593269-30593291 GGACACGGCCAAATAATATCAGG + Intergenic
988388627 5:30598639-30598661 GGACAGAGCAAAACCATATCAGG + Intergenic
988430628 5:31114891-31114913 GCACAGAGACAAACTGCATCAGG - Intergenic
988610714 5:32722083-32722105 GGACACAACCAAACCATAGCAGG + Intronic
988621694 5:32829910-32829932 GGACACAGCCAAACCATATTAGG + Intergenic
988650267 5:33141256-33141278 ATACACAGCCAAACTGTTTTTGG + Intergenic
988724782 5:33915793-33915815 GGACACAGCCAAACCATATCAGG - Intergenic
988806682 5:34746772-34746794 GGACACAGCCAAGACATATCAGG - Intronic
988965100 5:36408542-36408564 GGACATGGCCAAACCATATCAGG - Intergenic
988965627 5:36414558-36414580 GGACAGAGCCAAACCATATCAGG + Intergenic
989047192 5:37284527-37284549 GGACATAGCCAAACCATATCAGG + Intergenic
989100452 5:37818204-37818226 GGACACAGCCATACCATATCAGG - Intronic
989399555 5:40994151-40994173 GGACACAGCCAAACCATATCAGG + Intergenic
989458327 5:41667875-41667897 GGACATAGCCAAACCATATCAGG - Intergenic
989497474 5:42125837-42125859 GGACACAGCCAAACCATATCAGG - Intergenic
989690001 5:44130941-44130963 GAAGACAGCCAAACCATATCAGG - Intergenic
989711231 5:44399717-44399739 GGACACAGGCAAACCATATCAGG - Intergenic
989791209 5:45403685-45403707 GGACACAGCCAAACCATATCAGG + Intronic
990094404 5:52094238-52094260 GGACACAGGCAAACCATATAAGG - Intergenic
990117329 5:52404800-52404822 GGACACAGCCAAACCATTTCAGG - Intergenic
990122403 5:52471225-52471247 GGACACAGTTAAACCATATCAGG + Intergenic
990268549 5:54107299-54107321 GGGCACAGCCAAACTACATCAGG + Intronic
990364026 5:55050969-55050991 GGACACAGCCAAATCATATCAGG + Intergenic
990481329 5:56214215-56214237 GGGCACAGCCAAACAATATCAGG + Intronic
990706080 5:58531242-58531264 GGACAAAGCCAAACCATATTAGG + Intergenic
991116230 5:62959202-62959224 GGACACAGCCAAACCATATCAGG - Intergenic
991261044 5:64668774-64668796 GGACACAGCCAAATTATATCAGG - Intergenic
991532801 5:67634453-67634475 GGACACAGCCAAACTATATCAGG - Intergenic
991587032 5:68212012-68212034 GGACACAGCCAAACCATATCAGG + Intergenic
991696765 5:69280130-69280152 GGACACAGCCAAACCGTATCAGG + Intergenic
992412367 5:76518539-76518561 GGACACAGCCAAACCATATCAGG + Intronic
992488287 5:77216595-77216617 GGACACAGCCAAACCATATCAGG + Intronic
992836640 5:80648269-80648291 AGACACAGCCAAACCATATCAGG - Intronic
992874275 5:81037234-81037256 GGACACAGCCAAACCATATCAGG + Intronic
992885724 5:81157907-81157929 GGACACAGCCAAACCATATCAGG + Intronic
993001098 5:82381111-82381133 CGACACAGCCAAACCATATCAGG + Intronic
993065243 5:83090174-83090196 GGAAACAGCCAAACCATATCAGG - Intronic
993068206 5:83127256-83127278 GGAAATAGCCAAACCATATCAGG - Intronic
993414965 5:87615616-87615638 GGACATAGCCAAACAATATCAGG + Intergenic
993561493 5:89416701-89416723 GGACACAGCCAAACCATATCAGG - Intergenic
993588998 5:89770564-89770586 GGACACAGCCAAACCATATCAGG - Intergenic
993741023 5:91539798-91539820 GAACACAGCCAAACCATATCAGG - Intergenic
993791144 5:92212649-92212671 ACACAGAGCCAAACAGTATCAGG + Intergenic
993792690 5:92225748-92225770 GGACACAGCCAAACCATATCAGG + Intergenic
993809905 5:92463438-92463460 GGACACAGCCAAACCTTACCAGG + Intergenic
994004041 5:94817101-94817123 TGGCACAGCTAAACTGTGTCTGG + Intronic
994049779 5:95349261-95349283 GGACACAGCCAAACCATATCAGG - Intergenic
994271650 5:97784078-97784100 GGACACAGCCAAATCATATCAGG + Intergenic
994597472 5:101858293-101858315 GGACACAGCCAAATCATATCAGG + Intergenic
994688436 5:102986652-102986674 GTACACAGCCAAACCATATCAGG - Intronic
994786641 5:104173277-104173299 GGACACAGCCAAAACTTATCAGG + Intergenic
994897915 5:105729158-105729180 GGACACATTCAAACTGTAGTAGG - Intergenic
995154582 5:108894954-108894976 GGACACAGCCAAATCATATCGGG + Intronic
995277362 5:110292453-110292475 GGGCACAGACAAACCATATCAGG - Intronic
995349758 5:111161653-111161675 GGACACAGCTGAACCATATCAGG - Intergenic
995382857 5:111554239-111554261 ACACACAGCCAAACCATATCAGG - Intergenic
995828783 5:116330723-116330745 GGACACAGCCAAACCATATCAGG + Intronic
995926504 5:117381445-117381467 GGACACAGCCAAACCATATCAGG - Intergenic
995931702 5:117454577-117454599 GGACACAGCCAAGCCATATCAGG - Intergenic
996073876 5:119165886-119165908 GGACACAGCCAAACCATATCAGG + Intronic
996097983 5:119419442-119419464 GGACACAGTCAAACCATATCAGG - Intergenic
996232996 5:121088695-121088717 AGACAGAGCCAAACCATATCAGG + Intergenic
996234416 5:121108523-121108545 AGAGACTGCCAAACTGTGTCCGG - Intergenic
996268215 5:121569505-121569527 GGACACAGCCATACCATATCAGG - Intergenic
996290217 5:121843939-121843961 GGACACAGCCAAACCATATCAGG + Intergenic
996365953 5:122701671-122701693 AGACACAGCCAAATCATATCAGG + Intergenic
996486358 5:124040221-124040243 GGACACAGCCAAACCATATCAGG - Intergenic
996511349 5:124319775-124319797 GGACACAGACAAATCATATCAGG - Intergenic
996632110 5:125645799-125645821 ATACACAGCCAAATTCTATCAGG + Intergenic
996809842 5:127504709-127504731 GGACACAGCCAAACCATATCAGG - Intergenic
996916981 5:128723795-128723817 GGACACAGCCCAACCATATCAGG - Intronic
996973884 5:129407678-129407700 GGACACAGCCAAACTATATTAGG - Intergenic
997027416 5:130081519-130081541 GGACACAGTCAAACGATATCAGG - Intronic
997056408 5:130449967-130449989 GGACCCAGCCAAACCATATTAGG - Intergenic
997063130 5:130530485-130530507 AGAAACAGTGAAACTGTATCAGG + Intergenic
997092023 5:130869307-130869329 GGGCACAGCCAAACCATATCAGG + Intergenic
997879509 5:137576781-137576803 GGACTCAGCCTAACTGTATCAGG + Intronic
998569565 5:143245079-143245101 GGACATGGCCAAACCATATCAGG - Intergenic
998699809 5:144685173-144685195 AAACACAACCAAGCTGTATCAGG + Intergenic
998756475 5:145386367-145386389 AGACACAGCCAAATCATATCAGG + Intergenic
998793432 5:145791320-145791342 GAACATAGCCAAACCATATCAGG + Intronic
998795205 5:145811291-145811313 GGACACAGCAAAACCATATCAGG + Intronic
998873177 5:146573279-146573301 GGACACAGCCAAACCATATCAGG - Intergenic
998991362 5:147821511-147821533 ACACCGAGCCAAACTGTATCAGG - Intergenic
999082956 5:148861448-148861470 GGATACAGTCAAACCATATCTGG + Intergenic
999178443 5:149649042-149649064 GGACACAGCCAAATCATATCAGG + Intergenic
999540215 5:152563439-152563461 GGACACAGCCAAACCGTATCAGG - Intergenic
999686253 5:154105901-154105923 GGACACAGCCAAACCATATTAGG + Intronic
999935223 5:156479110-156479132 TGACATAGCCAGACTGTCTCAGG - Intronic
1000270480 5:159679015-159679037 GGACACAGCCCAACCATATTAGG - Intergenic
1000310780 5:160042252-160042274 AGTGACAGCCAAACTGTTTCAGG - Intronic
1000464460 5:161558634-161558656 AGCCACAGCCAAACCATATCAGG - Intronic
1000498141 5:162011631-162011653 GAACACAGCCAAACCATGTCAGG + Intergenic
1000637906 5:163664634-163664656 GGACACAGCCAAACCATATCAGG - Intergenic
1000660250 5:163929669-163929691 GGACACCGTCAAACCATATCAGG - Intergenic
1000746251 5:165037586-165037608 GGACACTGCCAACCCTTATCAGG - Intergenic
1001156364 5:169275821-169275843 GGACACAGCCAAACCATATCAGG + Intronic
1001202517 5:169731210-169731232 GGACACAGCCAAACCATATCAGG - Intronic
1001215584 5:169852954-169852976 GGACACAGCCAAACCATATCAGG - Intronic
1001613318 5:173021592-173021614 GGACACAGCCAAACCATATCAGG + Intronic
1002311523 5:178318046-178318068 GGACACAGCCACACCGTATCAGG + Intronic
1002464413 5:179399128-179399150 GGACACAGCCAAACCATATCAGG - Intergenic
1002588057 5:180265313-180265335 GGACACAGCCAAATCATGTCAGG - Intronic
1003006492 6:2387414-2387436 GGACACGGCCAAACCATATCAGG - Intergenic
1003214953 6:4100682-4100704 GGACAGAGCCAAATCATATCAGG - Intronic
1003352075 6:5327355-5327377 GGACACAGCCCAACCATATCAGG - Intronic
1003646389 6:7916008-7916030 GGACACAGCCAAACCATATCAGG - Intronic
1003729269 6:8802767-8802789 GGACACAGCCAAACCATATCAGG + Intergenic
1003849454 6:10206839-10206861 GGACACAGCCAAACCATATCAGG - Intronic
1003931103 6:10925328-10925350 GGACACAGCCAGACTGTATCAGG + Intronic
1004238486 6:13896940-13896962 GGACACAGCAAAATGATATCAGG + Intergenic
1004351177 6:14891786-14891808 GGGCACAGCCAAACTATATCAGG - Intergenic
1004455571 6:15788541-15788563 GGACACAGCTAAACCATATCAGG - Intergenic
1004468060 6:15904142-15904164 GGACACAGCCAAACCATATCAGG + Intergenic
1004741331 6:18464055-18464077 GGACACAGCCAAACCATATCAGG + Intronic
1004785723 6:18965327-18965349 GGACACAGCCAAACCATATCAGG + Intergenic
1005137862 6:22591688-22591710 GGACACAGCCAAACCATATCAGG + Intergenic
1005153447 6:22778235-22778257 GGACACAGCCAAACCATATCAGG - Intergenic
1005162092 6:22875855-22875877 GGACACAGCCAAACCATATTAGG + Intergenic
1005178490 6:23075446-23075468 GGACACAGCCAAACCATATCAGG + Intergenic
1005328924 6:24730621-24730643 GGACACAGGCAAACCATATCAGG - Intergenic
1005329875 6:24739659-24739681 GGACACAGCCAAACCATATAAGG - Intergenic
1005441105 6:25869829-25869851 GGACACATCCAAACCATATCAGG + Intronic
1005704584 6:28438817-28438839 GGACACAGCCAAACCATATCAGG + Intronic
1006696975 6:35939578-35939600 GGACACAGCTAAACCATATCAGG - Intergenic
1007116043 6:39344030-39344052 GGACACAGCCAAACCATATCAGG - Intronic
1007179371 6:39917449-39917471 GGACACAGCCAAACCATTTCGGG + Intronic
1007236567 6:40394649-40394671 GGACACAGCCAAACCATATCAGG - Intronic
1007268537 6:40617065-40617087 GGACACAGCCAAACCATATTAGG + Intergenic
1007658451 6:43467329-43467351 GGATGCAGCCAAACCATATCAGG - Intergenic
1007963877 6:45985842-45985864 GTACACAGCCAAACCACATCAGG - Intronic
1008233528 6:49014556-49014578 GAACACAGCCAAATCTTATCAGG + Intergenic
1008552344 6:52645205-52645227 GGACACAGCCAAACCATATCAGG - Intergenic
1008567585 6:52784344-52784366 ACACAGAGCCAAACTATATCAGG + Intergenic
1008571717 6:52823178-52823200 ACACAGAGCCAAACTATATCAGG + Intergenic
1008820780 6:55628645-55628667 GGACACTGCCAAATGATATCAGG - Intergenic
1008868114 6:56239868-56239890 GGACACAGGCAAACCATACCAGG - Intronic
1009029389 6:58038263-58038285 ACACACAGCCAAACCATATCAGG - Intergenic
1009194426 6:60666907-60666929 ACACAGAGCCAAACCGTATCAGG + Intergenic
1009204929 6:60789653-60789675 ACACACAGCCAAACCATATCAGG - Intergenic
1009445763 6:63740148-63740170 GGACACAGCCAAACCATATCAGG - Intronic
1009447743 6:63763430-63763452 GGACACAGCCAAACCATATCAGG - Intronic
1009517980 6:64643576-64643598 GGACACAGCCAAACCGTATCAGG - Intronic
1009699601 6:67159702-67159724 GGACACACCCAAACCATATCAGG - Intergenic
1010374295 6:75148800-75148822 GGACACAGCAAAACCATATCGGG - Intronic
1010408661 6:75535583-75535605 GGACACAGCAAAACCGTAACAGG + Intergenic
1010427148 6:75740284-75740306 GGAAACAGCCAAACCATATCAGG + Intergenic
1010709848 6:79161386-79161408 GAACACAGCCAAACTATATCAGG - Intergenic
1010713743 6:79205266-79205288 GGACACAGCTAAACCATATTAGG - Intronic
1010832439 6:80547275-80547297 GGACACAGCCAAACCATGTCAGG - Intergenic
1010884214 6:81216938-81216960 AGACACAGCGAAACCATATCAGG - Intergenic
1011108209 6:83806225-83806247 GAACACAGCCAAACCATAGCAGG + Intergenic
1011236728 6:85226792-85226814 ACACAAAGCCTAACTGTATCAGG + Intergenic
1011264249 6:85498567-85498589 GGATACAGCCAAACGATATCAGG + Intergenic
1011341491 6:86320122-86320144 AGACACAGCCAAACCATATCAGG + Intergenic
1011353715 6:86452447-86452469 GGACACAGCCAAACCATATAAGG - Intergenic
1011370921 6:86635399-86635421 GTACAGAGCCAAACCATATCAGG - Intergenic
1011905892 6:92366726-92366748 GGACACAGCTAAACCATATCGGG + Intergenic
1012141343 6:95630446-95630468 GGACACAGCCAAACCATATCAGG - Intergenic
1012190987 6:96279770-96279792 AGACAGAGCCAAACCATATCAGG - Intergenic
1012546460 6:100424958-100424980 GGAAACAGCCAAACCATATCAGG - Intronic
1012554572 6:100495797-100495819 ACACACAGCCAAACCATATCAGG + Intergenic
1012683068 6:102208403-102208425 GGACAAAGTCAAACAATATCAGG - Intergenic
1012715021 6:102657753-102657775 GGACACAGACAAACCATATCAGG + Intergenic
1012868643 6:104646899-104646921 GGACACAGCCAAACCATATCAGG - Intergenic
1013016272 6:106163386-106163408 GGACATAGTCAAACCATATCAGG + Intergenic
1013080949 6:106812057-106812079 GAAAACAGCCAAACCATATCAGG + Intergenic
1013090222 6:106893750-106893772 ACACAGAGCCAAACCGTATCAGG + Intergenic
1013302479 6:108817643-108817665 GGACACAGCCAAACCATATCAGG + Intergenic
1013717041 6:112974928-112974950 GGACACAGCAAAACCATATGAGG - Intergenic
1014211729 6:118715393-118715415 GGACACAGCCAAACCATATGAGG + Intergenic
1014283486 6:119467375-119467397 GTACACAGCCAAACCATATCAGG + Intergenic
1014303510 6:119712668-119712690 ACACACAGCCAAACCGTATCAGG - Intergenic
1014366993 6:120556261-120556283 GGTCACAGCCAAATCCTATCAGG - Intergenic
1014400758 6:120987097-120987119 GGACACAGCCAAACCATATCAGG + Intergenic
1014532759 6:122578720-122578742 GGACACAGCCAAGCCATATCAGG - Intronic
1014636062 6:123848319-123848341 GGACACAGCTAAACCATATCAGG - Intronic
1014780659 6:125560770-125560792 GGACACAGCCAAACCATATCAGG + Intergenic
1014958174 6:127648287-127648309 GGACACAGCCAAACCATATCAGG - Intergenic
1015129022 6:129789161-129789183 GCACACAGCCAAACCATATCAGG - Intergenic
1015173346 6:130279188-130279210 GGACACAGCCAAACCATATCTGG - Intronic
1015217636 6:130768201-130768223 GGACACAACCAAACCGTATCAGG + Intergenic
1015438486 6:133219201-133219223 GGACACAGCCAAACCGTATTAGG - Intergenic
1015516368 6:134086482-134086504 GGACACAGCTAAACCATATCAGG - Intergenic
1015753474 6:136584670-136584692 GGACACAGCCAAACCATATCAGG + Intronic
1015784233 6:136904437-136904459 GGACACAGCCAAACTATATCAGG - Intronic
1016061742 6:139637644-139637666 GGACACAGCTAAACCATATCAGG + Intergenic
1016185487 6:141193124-141193146 GGACAGAGCCAAACCATATCAGG + Intergenic
1016249782 6:142027142-142027164 GGACACAGCCAAACCATATGGGG - Intergenic
1016256750 6:142115863-142115885 GGACACAGCCAAAGCATATCAGG - Intergenic
1016281921 6:142427982-142428004 GGACACAGCCAAACCATATCAGG + Intronic
1016340508 6:143057369-143057391 GGACACAGCCAAACCGTATCAGG - Intergenic
1016347052 6:143124943-143124965 GGACACAGCCAAACCATATCAGG + Intronic
1016358810 6:143246552-143246574 AGACACAGCCAAACCACATCAGG + Intronic
1016460265 6:144274313-144274335 GGGCACAGCCTAACGATATCAGG + Intergenic
1016494937 6:144650293-144650315 GGACACAGCCAAACCATATCAGG + Intronic
1016620036 6:146098621-146098643 GGACACAGCCAAACCATATCAGG - Intronic
1016656883 6:146529001-146529023 GGACACAGCCAAACCATAGCAGG + Intergenic
1016737529 6:147495337-147495359 AGACACAGCCAAACCATATCAGG + Intergenic
1016862400 6:148733864-148733886 GGACACAGCCAAACCGTATCAGG + Intergenic
1016874924 6:148855219-148855241 GGACACAGCCAAACCGTATCAGG + Intronic
1016898618 6:149078829-149078851 GGACACAGCCAAACCATATTAGG - Intergenic
1016950732 6:149577153-149577175 GGGAACATCCAAACTATATCAGG + Intronic
1017019633 6:150129858-150129880 GGACACGGCCAAACCGTATCAGG + Intergenic
1017063017 6:150503973-150503995 ACACACAACCAAACTATATCAGG + Intergenic
1017134050 6:151132851-151132873 GGACACAGACAAACCATATCAGG - Intergenic
1017346598 6:153390622-153390644 GGACACAGCCAAACCATATCAGG - Intergenic
1017556459 6:155576525-155576547 GGACACAGCCAAACCATGTGAGG - Intergenic
1017575592 6:155798851-155798873 GGACATAGCCAAAACATATCAGG - Intergenic
1017949517 6:159124163-159124185 GGACACAGCCAAACCATATCAGG + Intergenic
1017979579 6:159388519-159388541 GAACAAAGCCAAACCATATCAGG - Intergenic
1018219634 6:161565369-161565391 GGACACAGCCAAACCATGTCAGG - Intronic
1018346385 6:162903699-162903721 AGACACAGCCAAACCGTATCAGG + Intronic
1018434316 6:163747365-163747387 GGACACAGCCAAACCATATCAGG + Intergenic
1018616207 6:165689397-165689419 ACAGACATCCAAACTGTATCAGG - Intronic
1018968886 6:168511549-168511571 GGACACAGCCAAACCATATCAGG + Intronic
1019045971 6:169146429-169146451 GGACACAGCCAAACCACATCAGG - Intergenic
1019615924 7:1961668-1961690 GGACACAGCCAAACCCTATCAGG - Intronic
1019824810 7:3275266-3275288 AGACACAGCCAAATCATATCGGG + Intergenic
1019887154 7:3915312-3915334 GGACACAGCCAAACCACATCAGG - Intronic
1019969656 7:4529929-4529951 GGACACAGCCAAACCATATCAGG + Intergenic
1020314044 7:6891909-6891931 GGACACAGCCAAACCATATCAGG - Intergenic
1020412374 7:7907545-7907567 GGACACAGCCAAACCATATCAGG - Intronic
1020493963 7:8823427-8823449 GGACACAGCCAAACCACATCAGG + Intergenic
1020932560 7:14416468-14416490 GGATGCAGCCAAACCGTACCAGG - Intronic
1020936451 7:14472172-14472194 GGAAACAGCCAAACCGTATCAGG - Intronic
1021152342 7:17167018-17167040 GGACACATTCAAATTGTAGCAGG + Intergenic
1021338957 7:19439574-19439596 ACACAAAGCCAAACTATATCAGG - Intergenic
1021418388 7:20416793-20416815 AGACACAGCCAAACCATACCAGG - Intergenic
1021656552 7:22879735-22879757 GGACACAGCCAAGCCATATCAGG - Intergenic
1021798334 7:24280071-24280093 GGACACAGCCAAACCATATCAGG - Intergenic
1022047920 7:26638160-26638182 GGACACAGCCAAACCGTATCAGG - Intronic
1022415316 7:30172193-30172215 GGACACAGCCAGACTATATGAGG - Intergenic
1022466718 7:30656984-30657006 GGAAACAGCCCCACTGTGTCAGG - Intronic
1023045894 7:36209904-36209926 GCAAACATCCAAACTATATCAGG + Intronic
1023137940 7:37072192-37072214 GAATACAGCCAAACCATATCAGG - Intronic
1023162333 7:37309410-37309432 GGACACAGCCAAACCATATCAGG + Intronic
1023505510 7:40896398-40896420 GGACACAGCCAAACCATATCAGG - Intergenic
1024156599 7:46632124-46632146 GGACACAGTCAAACCATATCGGG - Intergenic
1024289638 7:47793279-47793301 GGACACAACCAAACCATATCAGG - Intronic
1024674140 7:51623086-51623108 GGACACAGCCAAACCATATCAGG - Intergenic
1024729124 7:52235226-52235248 ATACAGAGCCAGACTGTATCAGG - Intergenic
1024914785 7:54487021-54487043 GGACATAGCCAAACCATGTCAGG + Intergenic
1025291968 7:57736118-57736140 GGACACAGCCAAACCCTAACAGG - Intergenic
1026122218 7:67548014-67548036 GGACACAGCCAGATCATATCAGG - Intergenic
1026334670 7:69383494-69383516 ACATACATCCAAACTGTATCAGG - Intergenic
1026349007 7:69499474-69499496 GGACACAGCCAAATCATATCAGG - Intergenic
1026546483 7:71327536-71327558 GGACATAGCCAAACCATATCAGG + Intronic
1026569222 7:71514814-71514836 GGACACAGCCAAACCATATCAGG - Intronic
1026571448 7:71534759-71534781 GGACACAGCCAGACCACATCAGG + Intronic
1026573655 7:71554146-71554168 GGACAGAACCAAACCATATCAGG - Intronic
1026610778 7:71858027-71858049 GGACACAGCCAAACCATATCAGG - Intronic
1026619141 7:71935051-71935073 GCAAACAGCCAAACCATATCAGG + Intronic
1026631786 7:72044110-72044132 GGACACAACCAAACCACATCAGG + Intronic
1026671116 7:72391511-72391533 GGACATAGCCAAATTATATCAGG - Intronic
1026687484 7:72523851-72523873 GGACACAACCAAACCATATCAGG - Intergenic
1027348466 7:77286436-77286458 GGACACATCGAAACCATATCAGG + Intronic
1027990861 7:85359663-85359685 GGACACAGCCAAATCATATCAGG - Intergenic
1027992876 7:85385549-85385571 GGACACAGCCAAACCATATCAGG - Intergenic
1028054322 7:86224012-86224034 GGACACAGCAAAACTGTATCAGG + Intergenic
1028318270 7:89431300-89431322 GGACACAGCCAAACCATATCAGG + Intergenic
1028447674 7:90943834-90943856 GGAAACACTCAAACTGTAGCAGG - Intronic
1028720262 7:94022612-94022634 GGACACAGCTGAACCATATCAGG - Intergenic
1029153766 7:98500331-98500353 GGACACAGCCGAACCATATCAGG + Intergenic
1029510074 7:100988737-100988759 GGACACAGCCAAACCATATCTGG - Intronic
1029851622 7:103467063-103467085 GGGCACAGCCAAACCATATCAGG + Intergenic
1030187379 7:106777281-106777303 GGACAGGGCCAAACCATATCAGG + Intergenic
1030907802 7:115207751-115207773 GGACACAGTCAAACCATATCAGG + Intergenic
1030916310 7:115318378-115318400 GGACACAGCCAAATCATATGAGG - Intergenic
1030938614 7:115617215-115617237 GGACATGGCCAAACCATATCAGG + Intergenic
1031012562 7:116539022-116539044 GGACACAGCCAAACCATATCAGG + Intronic
1031453437 7:121950313-121950335 GGACACAGACAAACCATGTCAGG + Intronic
1031616950 7:123893121-123893143 GGACAAAGCCAAACCATATCAGG - Intergenic
1031645435 7:124220416-124220438 GGACACTGCCAGACCATATCAGG - Intergenic
1032534670 7:132652875-132652897 GGACACAGCCAAACCATATTGGG - Intronic
1032535484 7:132659710-132659732 GTACACAACCAAACCATATCAGG - Intronic
1032608937 7:133390070-133390092 GGACACAGCGAAGCCATATCAGG + Intronic
1032670249 7:134075680-134075702 GGACACAGCCAAACCATATCAGG + Intergenic
1032691112 7:134287916-134287938 GGACACAGCCGAACCATATCAGG - Intergenic
1032728337 7:134613101-134613123 GGACACAGCCAAACCATATCAGG + Intergenic
1032859168 7:135861449-135861471 GCACACAGCCAAACCATATCAGG + Intergenic
1032894647 7:136236906-136236928 AGACACAGCCAAACCATATCAGG + Intergenic
1032904345 7:136347339-136347361 GGACACAGCCAAACCATATCAGG + Intergenic
1033040105 7:137909757-137909779 GGACACAGCCAAACCATATCAGG - Intronic
1033410301 7:141111396-141111418 GGACACAGCCAAACCATATGAGG + Intronic
1033429953 7:141280291-141280313 GGACACAGCCAAACTATATCAGG - Intronic
1033486927 7:141799747-141799769 GGACACAGCTAAACCATATCAGG - Intergenic
1033501726 7:141957703-141957725 GGACACAGCCAAACCATAAATGG + Intronic
1033961734 7:146921742-146921764 GGACACAGCCAAACCATTTCAGG + Intronic
1034009135 7:147508583-147508605 GGACACAGCCAAAGAATATCCGG - Intronic
1034133470 7:148742526-148742548 GGACACAGCCAAACCATGTCAGG + Intronic
1034134907 7:148757999-148758021 GGACATAGCCAAACCATATCAGG + Intronic
1034689446 7:153002258-153002280 ACACACAGCCAAACCATATCAGG + Intergenic
1034731140 7:153388492-153388514 CGACACAGCCAGACCATATCAGG + Intergenic
1034884885 7:154791593-154791615 GGACATGGCCAAACCATATCAGG + Intronic
1035205707 7:157292799-157292821 GGACACAGCCTCACCCTATCAGG + Intergenic
1035524335 8:300614-300636 GGCCACAGCCACACTGTAAGGGG - Intergenic
1035728053 8:1836711-1836733 GGACACAGCCAAACCATATCAGG - Intronic
1035919988 8:3666540-3666562 GGACACAGCCAAACCATATCAGG - Intronic
1036130087 8:6102056-6102078 GGACACAGTCAAACCATATCAGG + Intergenic
1036202045 8:6778119-6778141 GGCAACATACAAACTGTATCAGG + Intergenic
1036455408 8:8902408-8902430 GGACACAGTCAAACCATATCAGG + Intergenic
1036457934 8:8925830-8925852 GAGCACAGCCAAACCATATCAGG + Intergenic
1037182732 8:16026595-16026617 GGACACAGTCAAACTATATCAGG + Intergenic
1037315834 8:17598676-17598698 GGAAACAGCCAAACCATATCAGG - Intronic
1037564498 8:20106050-20106072 GGACACAGTCAAACCAAATCTGG + Intergenic
1037702005 8:21283797-21283819 GGACACAGCCAAACCATATCAGG + Intergenic
1037961063 8:23098728-23098750 ACACACATGCAAACTGTATCAGG + Intronic
1038002080 8:23400524-23400546 GGACACAGCCAAGCCATATCAGG + Intronic
1038125322 8:24666923-24666945 GGACACAGCCAAACCATTTCAGG + Intergenic
1038278364 8:26140677-26140699 GGACACAGCCAAACCATTTCAGG + Intergenic
1038458732 8:27697589-27697611 GGACACAGCCAAACCATATCGGG - Intergenic
1038741164 8:30218360-30218382 GGACACAGCCAAATCATATCAGG - Intergenic
1038752786 8:30312565-30312587 GGACACAGCCAAGCCATATCAGG - Intergenic
1038842649 8:31200331-31200353 GGACACAGCCAAACAATATCAGG - Intergenic
1038848512 8:31251928-31251950 GGACACAGCCAAGCCGTATCAGG + Intergenic
1038936592 8:32258812-32258834 GGGCACAGCCAAAACATATCAGG + Intronic
1038940731 8:32301861-32301883 GGACACAGCCAAACCATATCAGG + Intronic
1039018809 8:33182984-33183006 GGACACAGCCAAACTATATCAGG - Intergenic
1039025715 8:33255724-33255746 GGACACTGCCAAACCATATCAGG + Intergenic
1039029457 8:33293852-33293874 GGACACAGCCAAACCATATCAGG + Intergenic
1039118695 8:34121536-34121558 GGACACAGCCAAACCATATCAGG + Intergenic
1039163513 8:34649806-34649828 TGACACAGACAAACCATATCAGG - Intergenic
1039491267 8:37949253-37949275 GAACAGAGCCAAACCATATCAGG - Intergenic
1039574111 8:38609946-38609968 GGACACAGCCAAACCATATCAGG + Intergenic
1039657427 8:39424647-39424669 GGACACAGCCAAACCATATCAGG + Intergenic
1039739811 8:40372373-40372395 GGACACAGCCAAACTATATCAGG - Intergenic
1040384932 8:46908537-46908559 GGACACAGCCAAACTATATCAGG - Intergenic
1040428587 8:47314726-47314748 AGACACAGCCAAACCATATCAGG + Intronic
1040463833 8:47676060-47676082 GGACACAGCCAGACAGGACCTGG + Intronic
1040554723 8:48468587-48468609 GGACACAGTCAAACCATATCAGG + Intergenic
1040579629 8:48687180-48687202 GGACAGAGTCAAACCATATCAGG - Intergenic
1040623567 8:49117743-49117765 GGACACAGCCAAACTATATCAGG + Intergenic
1040655034 8:49498237-49498259 GGACAGAGCCAAACCATATCAGG - Intergenic
1041042336 8:53859978-53860000 GGACACAGCCAAACCATATCGGG + Intronic
1041118812 8:54566052-54566074 GGACACAGCCCAGCTGGATTCGG + Intergenic
1041403601 8:57471378-57471400 GGACACAGCCAAACCATATCAGG + Intergenic
1042147441 8:65744924-65744946 GGACACAGCCAAACCATATCAGG - Intronic
1042376349 8:68057003-68057025 GGACACAGCCAAACCATATGAGG - Intronic
1042403653 8:68378096-68378118 GGACACAGCCAAACCGTATCAGG + Intronic
1042422037 8:68602629-68602651 GGAAACAGCCAAACCATATGAGG + Intronic
1042485265 8:69340127-69340149 GGACACAGCCAAACCATATCAGG - Intergenic
1042782281 8:72504917-72504939 GGATACAGCCAAACAATATCAGG + Intergenic
1042826204 8:72982509-72982531 GGACACAGCCAAACCATATCAGG - Intergenic
1043214796 8:77572414-77572436 AGGCACAGCCAAACCATATCAGG + Intergenic
1043308069 8:78822341-78822363 GGACACAGCCAAACCATATCAGG - Intergenic
1043635790 8:82379417-82379439 AGACACAGCCAAACCATATTCGG + Intergenic
1043826726 8:84938134-84938156 TATCACAGCCAAACTATATCAGG - Intergenic
1044017312 8:87059773-87059795 GGGCACAGCCAGACCATATCAGG + Intronic
1044070650 8:87755912-87755934 GAACACAGCCAAACTGTATCAGG + Intergenic
1044087353 8:87957036-87957058 GGACACAGCCAAACCATATCAGG + Intergenic
1044228380 8:89745067-89745089 GGACACAGCCAAACTGTATCAGG + Intergenic
1044279557 8:90339855-90339877 GGACACAGCCAAACAATATCAGG - Intergenic
1044525642 8:93247921-93247943 ACACAGAGCCAAACTATATCAGG - Intergenic
1044758075 8:95488073-95488095 GGAAACAGCCAAACCATATCAGG - Intergenic
1044784498 8:95780197-95780219 GGACACAGCCAAACCATATCAGG - Intergenic
1045176210 8:99727734-99727756 ACACAGAGCCAAACAGTATCAGG + Intronic
1045219302 8:100181739-100181761 GGACACAGTCATACTGGATTAGG + Intronic
1045309705 8:100990287-100990309 GGACATAGCAAAACCGTATCAGG + Intergenic
1045394817 8:101750282-101750304 GGACACAGCCAAACCATATCAGG + Intronic
1045437758 8:102181688-102181710 GGACACAGCCAAACCATATCAGG - Intergenic
1045715867 8:105044368-105044390 ACACACAGCCAAACCATATCGGG + Intronic
1045916840 8:107481951-107481973 GGGCACAGCCAAACCATATCAGG + Intronic
1046016555 8:108612168-108612190 GGACACAGCCAAACTATATCAGG + Intronic
1046028601 8:108755320-108755342 GGACACAGTTAAACTGTGCCTGG + Intronic
1046175370 8:110568995-110569017 TGACACAGCCAAACCATATCGGG + Intergenic
1046533219 8:115473487-115473509 GGACACAGCCAAACCATATCAGG + Intronic
1046717840 8:117586775-117586797 GGACACAGGCAAACTATGTCAGG - Intergenic
1046786625 8:118273405-118273427 GGACACGGCCAAACCATATCAGG + Intronic
1046882098 8:119320419-119320441 GGACACAGCCAAACCATATCAGG + Intergenic
1047488070 8:125350813-125350835 GGACACAGCCAAACCATATTAGG + Intronic
1047822362 8:128535322-128535344 GGACACAGCCAAACCATAGCAGG + Intergenic
1047826926 8:128586713-128586735 GGACACAGCCAAACCATGTCAGG - Intergenic
1047843321 8:128778010-128778032 GGACATAGCCAAACTGTATCAGG - Intergenic
1047860972 8:128966179-128966201 GGATATAGCCAAACCATATCAGG + Intergenic
1047899653 8:129406156-129406178 GGACACAGCCAAACCATATCAGG + Intergenic
1047969450 8:130072227-130072249 GGACACAGCCAAGCTATATCAGG - Intronic
1048014867 8:130488267-130488289 GACAACATCCAAACTGTATCAGG + Intergenic
1048016565 8:130502215-130502237 GGATACAGCCAAACCATATCAGG - Intergenic
1048412737 8:134192261-134192283 GGAAACAGCCAAACCATATCAGG + Intergenic
1048579382 8:135718730-135718752 GGACACAGCCAAACCTTATCAGG + Intergenic
1048614242 8:136056965-136056987 GGGTACAGCCAAACCATATCAGG - Intergenic
1048633367 8:136268695-136268717 GGACCCAGCCAAACCATAACAGG - Intergenic
1048652542 8:136495022-136495044 GGACACAGCCAAACCATATCAGG + Intergenic
1048653382 8:136506433-136506455 GGACACAGCCAAACCATATCAGG - Intergenic
1048660767 8:136598777-136598799 GGACACAGCCAAACCATATCAGG - Intergenic
1048737016 8:137513236-137513258 GGACACAGCCAAACCGTATCAGG - Intergenic
1048773298 8:137918889-137918911 GGCCACAGCCAAACCATACCAGG - Intergenic
1048872867 8:138813216-138813238 GGACACAGCCAAGCCAGATCAGG - Intronic
1048895917 8:138992064-138992086 GGACACAGCAAAACTATATCAGG + Intergenic
1048917554 8:139199346-139199368 GGACCCAGCCAAACCATATCAGG - Intergenic
1049479338 8:142813277-142813299 GGACACAGTGAAACCGTATCGGG + Intergenic
1049581973 8:143416771-143416793 GGACACAGCCGAAACATATCAGG + Intergenic
1050189493 9:3010012-3010034 GGACACAGCCAAACCATATCAGG + Intergenic
1050356283 9:4786058-4786080 GAAAACAGCCAAACCATATCAGG - Intergenic
1050695709 9:8277013-8277035 GGACACAGCCAAACCATATCAGG + Intergenic
1050809630 9:9727908-9727930 GAACACAGCCAAATCATATCAGG - Intronic
1050940364 9:11450667-11450689 GGACACAGCTAAACCATATCAGG - Intergenic
1051043725 9:12848206-12848228 GGACACAGCAAAACCATATCAGG + Intergenic
1051698971 9:19799309-19799331 GGAAACAGAAAAAGTGTATCAGG - Intergenic
1051914875 9:22196989-22197011 GGACACAACCAAACTATATCAGG - Intergenic
1051957305 9:22712041-22712063 AGACACAGCCAAACTATATGTGG - Intergenic
1052156947 9:25203836-25203858 GGACACAGCCAAACCATATCAGG + Intergenic
1052477029 9:28972967-28972989 ATACACAGCCAAACCATATCAGG + Intergenic
1052554360 9:29994694-29994716 GGACACTGCCAAACCATATCAGG + Intergenic
1052599339 9:30604473-30604495 GGACACAGCAAAACCATATCAGG - Intergenic
1052622086 9:30925459-30925481 GGACACAGCCAAACTGTATCAGG + Intergenic
1052625869 9:30977220-30977242 TGACACAGCCAAACCATATCAGG - Intergenic
1052637434 9:31122699-31122721 GGACATAGCCAAACTCTATCAGG + Intergenic
1052678549 9:31658307-31658329 GAACACAGCCAAACCATATCAGG + Intergenic
1052747969 9:32459939-32459961 GGACACAGCCAAACCATATCAGG - Intronic
1052969581 9:34369195-34369217 GGACACAGCCAAACCATATCAGG + Exonic
1053114367 9:35489060-35489082 GGACACAGCCAAACTGTTACAGG - Intergenic
1053321060 9:37099225-37099247 GGACAGAGTGAAACTGTGTCTGG - Intergenic
1053371169 9:37562957-37562979 GGACACAGCCAAACCATATCAGG - Intronic
1053397968 9:37791714-37791736 GGACACAGCCAAACCATATCAGG + Intronic
1053918300 9:42962339-42962361 ACACACATCCAAACTATATCAGG - Intergenic
1054164538 9:61709584-61709606 GGACACAGCGAAACCCTAACAGG + Intergenic
1054379644 9:64476091-64476113 ACACACATCCAAACTATATCAGG - Intergenic
1054850432 9:69841957-69841979 GGACATAGCCAAACCATATCAGG + Intronic
1055083652 9:72291948-72291970 ACACAGAGCCAAACTATATCAGG + Intergenic
1055367096 9:75556352-75556374 GGACACAGCCCAACCATATCAGG - Intergenic
1055598992 9:77895667-77895689 ACACCGAGCCAAACTGTATCAGG - Intronic
1055680528 9:78710619-78710641 AGACACAGCCAAACCATATCAGG - Intergenic
1055682184 9:78726935-78726957 AGACACAGGCTAACTGTATCAGG + Intergenic
1055698486 9:78916010-78916032 ACACAAAGCCAAACTTTATCAGG - Intergenic
1055799834 9:80022902-80022924 GGACACAGGCAAACCATATCTGG - Intergenic
1056019021 9:82422568-82422590 GGACACAGCCAAACAATATCGGG - Intergenic
1056070888 9:82985479-82985501 GGACACAGCCAAACCATATCAGG + Intronic
1056121787 9:83495380-83495402 GGACAGAGCCAGACTGGAGCAGG + Intronic
1056185087 9:84126446-84126468 GGACCCAGCCACTCTGTGTCTGG + Intergenic
1056237315 9:84607753-84607775 GGACACAGCTAAACCATATCAGG + Intergenic
1056240523 9:84642084-84642106 GGGCACAGCCAAATGATATCTGG - Intergenic
1056945937 9:90996842-90996864 GGACACAGCCAAACCATATAGGG - Intergenic
1057556973 9:96095694-96095716 GGATACAGCCAAACCATTTCAGG - Intergenic
1057732193 9:97620056-97620078 GGACACAGCCAAGCAATATCAGG - Intronic
1057935803 9:99237824-99237846 GGACACAGCCAAACCATATCAGG - Intergenic
1058065816 9:100546503-100546525 GGACACAGCCAAACCACATCAGG + Intronic
1058221781 9:102312536-102312558 GGACACAACCAAACCATATTAGG - Intergenic
1058366334 9:104213459-104213481 GGACACAGCCAGACCATATCAGG + Intergenic
1058462433 9:105195652-105195674 GGATACAGCCAAAGTATCTCCGG + Intergenic
1058604093 9:106702339-106702361 GGACACAGCCAAACTATGTCAGG - Intergenic
1058940362 9:109807733-109807755 GGACATAGCTAAACCATATCAGG - Intronic
1058961403 9:109995764-109995786 GGACACTGCCAAACCATATCAGG + Intronic
1059040860 9:110814139-110814161 GGACACAGCAAAACCATATCAGG + Intergenic
1059069664 9:111121719-111121741 GGACACAGCCAAACTGTATCAGG + Intergenic
1059565720 9:115381572-115381594 GGACACAGCCAAACCATATCAGG + Intronic
1059587425 9:115620892-115620914 GGACACAGCCAAACCATATCAGG + Intergenic
1059716475 9:116917862-116917884 TGACACAGCCAAACCATATCAGG - Intronic
1059716953 9:116921925-116921947 GGACACAGCCAAACCATATCAGG + Intronic
1059753771 9:117273342-117273364 GAACACAGCCAAACCATATCAGG + Intronic
1059830298 9:118087721-118087743 AGACACAGCCAAACCATATCAGG - Intergenic
1059868646 9:118545998-118546020 GGACACAGCCAAACCATATCAGG + Intergenic
1059903625 9:118956552-118956574 GGACACAGCCAAACCATATCTGG + Intergenic
1059986122 9:119822468-119822490 GGACACAGCCAAATCATATGAGG - Intergenic
1060021502 9:120135206-120135228 GGACACAGCCAAACCATATCAGG + Intergenic
1060801247 9:126547206-126547228 GGGCACAGCCAAACCATAACAGG + Intergenic
1060894102 9:127206630-127206652 GGACACAGCCAAACCATATCAGG + Intronic
1061363914 9:130160625-130160647 GGACACAGCCAAACCACATCAGG + Intergenic
1061381039 9:130257806-130257828 GGACATAGCCAAACCATATCAGG - Intergenic
1061659075 9:132116286-132116308 AGACACAGCCAAACCATATCAGG - Intergenic
1203635581 Un_KI270750v1:107383-107405 GGGCACAGCCAATCCATATCGGG + Intergenic
1185820956 X:3203930-3203952 GGATACAGCTAAACCATATCAGG - Intergenic
1186124616 X:6399876-6399898 GGAGACAGACAAACTGCATCAGG + Intergenic
1186150808 X:6672740-6672762 GGATACAGCCAAACCATATCAGG - Intergenic
1186262756 X:7797901-7797923 GGACACAGCCAAACCATATCAGG - Intergenic
1186267953 X:7852067-7852089 GGACACAGCCAAACCATATCAGG + Intergenic
1186291819 X:8108517-8108539 GGACACAGCCAAACCATATTAGG + Intergenic
1186335344 X:8581098-8581120 GGACACAGCCAAACCATATCAGG - Intronic
1186609426 X:11124602-11124624 GGCCACAGCCAAACCATATCAGG - Intergenic
1186822363 X:13303584-13303606 GGACACAGCCAAACCATATCAGG + Intergenic
1187136487 X:16552239-16552261 GGACACAGCCAAACCATATCAGG + Intergenic
1187290773 X:17951187-17951209 GGACACAGCCAAACCATATCAGG + Intergenic
1187298855 X:18028895-18028917 GGACACAGTCAAACCATATCGGG - Intergenic
1187614601 X:20979794-20979816 GGACACAGCCAGACCATAGCAGG + Intergenic
1187619290 X:21031947-21031969 GGACGCAGCCAAACTATATCAGG + Intergenic
1187792678 X:22968016-22968038 GGACAGAGCCAAACCATATCGGG + Intergenic
1187792871 X:22969944-22969966 GGACACAGCCAAACCGTATCAGG - Intergenic
1188063294 X:25627347-25627369 GGACACAGTCATACTGGATTAGG - Intergenic
1188090515 X:25959071-25959093 GGACACAGCCAGACCACATCAGG - Intergenic
1188103711 X:26122860-26122882 AAACACAGTCAAACTATATCAGG + Intergenic
1188138962 X:26525171-26525193 GGACACAGCCAAACCATATCAGG + Intergenic
1188355208 X:29182239-29182261 GGAAACAGAAAAACTGAATCTGG + Intronic
1188790509 X:34403688-34403710 GGACACAGCCAAACCATATCAGG - Intergenic
1188888465 X:35580966-35580988 ACACACATCCAAACTATATCTGG - Intergenic
1188957267 X:36448477-36448499 GTACACAGCCAAACCAAATCAGG + Intergenic
1188996649 X:36894706-36894728 GGACACAGCCAAACTGTATCAGG - Intergenic
1189023664 X:37369654-37369676 GGACACAGCCAAACCATATCAGG - Intronic
1189137828 X:38567537-38567559 GGACACAGCCAAACCATATCAGG + Intronic
1189423645 X:40879512-40879534 GGACACAGCCAAGCCATATCAGG + Intergenic
1189671976 X:43420588-43420610 GGACAGAGCCAAACCATATCAGG + Intergenic
1189874527 X:45421890-45421912 GGAAACAGCCAAACTATACCAGG - Intergenic
1189952274 X:46245068-46245090 GGACACAGCCAAACCATAACAGG - Intergenic
1190150661 X:47944720-47944742 GGACACAGCTAAACCATATCAGG - Intronic
1190513411 X:51196647-51196669 GGACACAGCCAAACCATATCAGG + Intergenic
1190527942 X:51346688-51346710 GGACACAGCCAAACCATATCAGG + Intergenic
1190557763 X:51653576-51653598 GGACACATCCAAACTATATCAGG + Intergenic
1190974364 X:55385332-55385354 CGATACAGCCAAACCATATCAGG - Intergenic
1191070683 X:56396996-56397018 GGACACAGCCAAACCATATTAGG - Intergenic
1191116575 X:56858962-56858984 GGACACAGTCAAACCATATCAGG + Intergenic
1191587894 X:62848854-62848876 GGACACACCCAAACTGTATCAGG + Intergenic
1191661155 X:63652730-63652752 ACACAGAGCCAAACCGTATCAGG - Intronic
1191694860 X:63979007-63979029 GGGCCCAGCCAAACCATATCAGG - Intergenic
1191826803 X:65374995-65375017 AGACACAGCCAAACCATATCAGG + Intronic
1191842580 X:65523768-65523790 GGACAGAGCCAAACTTTCTGAGG - Intronic
1192279370 X:69668062-69668084 GGACACATTCAAACAATATCAGG + Intronic
1192309276 X:69996696-69996718 ACACAGAGCCAAACTGTATCAGG - Intronic
1192489877 X:71566661-71566683 GGACACAGTCAAACTATGTCAGG + Intronic
1192966766 X:76185052-76185074 GGACTCAGTTAAACTGTACCTGG + Intergenic
1193219901 X:78912431-78912453 GGACACAGCCAAATTATATCAGG - Intergenic
1193647893 X:84090797-84090819 GGACACAGCCAAAACATATCAGG + Intronic
1193750671 X:85339369-85339391 GTACACAGCCAAACTATATCAGG + Intronic
1193761328 X:85470003-85470025 GGACAGAGCCAAACCATATCAGG - Intergenic
1193813970 X:86083922-86083944 GGTCACAGCCAAATCATATCAGG - Intergenic
1194060221 X:89187439-89187461 GAATACAGCCAAACTGTTCCTGG + Intergenic
1194131610 X:90088783-90088805 GGACACAGCCAAACCATATCAGG + Intergenic
1194300447 X:92180576-92180598 GGACACAGCCAAACCATATTAGG - Intronic
1194428619 X:93771907-93771929 GGACACAGCCAAACCATATCAGG + Intergenic
1194503631 X:94707266-94707288 GGACATAGCCAAACCATATCAGG + Intergenic
1194560163 X:95410663-95410685 GGACATGGCCAAACCATATCAGG - Intergenic
1194608376 X:96009647-96009669 GGATACAGTCAAACCATATCAGG - Intergenic
1194639143 X:96381629-96381651 GGACACAGCCCAACTATATCAGG + Intergenic
1194756143 X:97742204-97742226 GGACACAGCCAAACCACATCAGG - Intergenic
1195195918 X:102497958-102497980 GGACACAGCCAAACAATATCAGG - Intergenic
1195281683 X:103340757-103340779 GGACACAGCCAAACCATATCAGG - Intergenic
1195770047 X:108341312-108341334 GGACACAGCCAAACCATACAGGG - Intronic
1196558796 X:117122245-117122267 GGATGCAGCCAAACCATATCAGG + Intergenic
1196595067 X:117536545-117536567 GGACACAGCCAAACCATATCAGG - Intergenic
1197482775 X:127007615-127007637 GGAAATAGCCAAACCGTATCAGG - Intergenic
1197568439 X:128117700-128117722 GGACACAGCCAAAACATATCAGG + Intergenic
1197688754 X:129474736-129474758 GGACACAGCCAAACCATATCAGG - Intronic
1198071606 X:133153877-133153899 GGACACAGCCAAACCATATCAGG - Intergenic
1198133202 X:133720283-133720305 GGACACAGTGAAACCATATCAGG - Intronic
1198314319 X:135451313-135451335 AGAAACATCCAAACTATATCTGG + Intergenic
1198370048 X:135981450-135981472 AGACAGAGCCAAACCATATCAGG + Intergenic
1198996619 X:142580096-142580118 GGACACAGCCAAACCATGTCAGG - Intergenic
1199006848 X:142709877-142709899 GGACGCAGCCAAACCATATCAGG - Intergenic
1199070206 X:143467556-143467578 GGACATAGCCAAAACATATCAGG + Intergenic
1199100096 X:143789588-143789610 GGACACAGCCAAACCATATTAGG + Intergenic
1199172676 X:144749886-144749908 GGACACAGTCAAACCATATTTGG - Intergenic
1199205575 X:145145135-145145157 AGACAGAGCCCAACTATATCAGG + Intergenic
1199307515 X:146284448-146284470 GGACACAGCCAAACCATATCAGG - Intergenic
1199310213 X:146312784-146312806 GGACACAGCCAAGCCATATCAGG + Intergenic
1199318124 X:146404440-146404462 GAACAGAGCCAAACCATATCAGG - Intergenic
1199363047 X:146944622-146944644 GGACATAGCCAAACCATATTGGG + Intergenic
1199400567 X:147394327-147394349 GGATACAGCCAAACCATATCAGG - Intergenic
1199590677 X:149465511-149465533 AGAAACAGCCAAACTGTATCAGG + Intergenic
1199656307 X:149998504-149998526 GCACAGAGCCAAACCATATCAGG + Intergenic
1199776267 X:151014500-151014522 ACACACAGCCAAACCATATCAGG + Intergenic
1199824184 X:151481671-151481693 GGACACAGCCAAACCATATCAGG - Intergenic
1200295549 X:154915288-154915310 GGACACAGCCAAACCATATCTGG + Intronic
1201258017 Y:12128760-12128782 GGATACAGCTAAACCATATCAGG + Intergenic
1201465335 Y:14274504-14274526 GGAAACAGCCAAACCATAGCAGG - Intergenic