ID: 984512978

View in Genome Browser
Species Human (GRCh38)
Location 4:180701558-180701580
Sequence GCTCCTGTTGGGCCACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512978_984512981 -6 Left 984512978 4:180701558-180701580 CCAGCTGGTGGCCCAACAGGAGC No data
Right 984512981 4:180701575-180701597 AGGAGCAAACTCCATTCACTTGG No data
984512978_984512982 2 Left 984512978 4:180701558-180701580 CCAGCTGGTGGCCCAACAGGAGC No data
Right 984512982 4:180701583-180701605 ACTCCATTCACTTGGTCCACTGG No data
984512978_984512984 4 Left 984512978 4:180701558-180701580 CCAGCTGGTGGCCCAACAGGAGC No data
Right 984512984 4:180701585-180701607 TCCATTCACTTGGTCCACTGGGG No data
984512978_984512987 21 Left 984512978 4:180701558-180701580 CCAGCTGGTGGCCCAACAGGAGC No data
Right 984512987 4:180701602-180701624 CTGGGGTCCACCCCTCACAGTGG No data
984512978_984512989 23 Left 984512978 4:180701558-180701580 CCAGCTGGTGGCCCAACAGGAGC No data
Right 984512989 4:180701604-180701626 GGGGTCCACCCCTCACAGTGGGG No data
984512978_984512988 22 Left 984512978 4:180701558-180701580 CCAGCTGGTGGCCCAACAGGAGC No data
Right 984512988 4:180701603-180701625 TGGGGTCCACCCCTCACAGTGGG No data
984512978_984512983 3 Left 984512978 4:180701558-180701580 CCAGCTGGTGGCCCAACAGGAGC No data
Right 984512983 4:180701584-180701606 CTCCATTCACTTGGTCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512978 Original CRISPR GCTCCTGTTGGGCCACCAGC TGG (reversed) Intergenic
No off target data available for this crispr