ID: 984512981

View in Genome Browser
Species Human (GRCh38)
Location 4:180701575-180701597
Sequence AGGAGCAAACTCCATTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512978_984512981 -6 Left 984512978 4:180701558-180701580 CCAGCTGGTGGCCCAACAGGAGC No data
Right 984512981 4:180701575-180701597 AGGAGCAAACTCCATTCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512981 Original CRISPR AGGAGCAAACTCCATTCACT TGG Intergenic
No off target data available for this crispr