ID: 984512982

View in Genome Browser
Species Human (GRCh38)
Location 4:180701583-180701605
Sequence ACTCCATTCACTTGGTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512978_984512982 2 Left 984512978 4:180701558-180701580 CCAGCTGGTGGCCCAACAGGAGC No data
Right 984512982 4:180701583-180701605 ACTCCATTCACTTGGTCCACTGG No data
984512980_984512982 -10 Left 984512980 4:180701570-180701592 CCAACAGGAGCAAACTCCATTCA No data
Right 984512982 4:180701583-180701605 ACTCCATTCACTTGGTCCACTGG No data
984512979_984512982 -9 Left 984512979 4:180701569-180701591 CCCAACAGGAGCAAACTCCATTC No data
Right 984512982 4:180701583-180701605 ACTCCATTCACTTGGTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512982 Original CRISPR ACTCCATTCACTTGGTCCAC TGG Intergenic
No off target data available for this crispr