ID: 984512988

View in Genome Browser
Species Human (GRCh38)
Location 4:180701603-180701625
Sequence TGGGGTCCACCCCTCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984512978_984512988 22 Left 984512978 4:180701558-180701580 CCAGCTGGTGGCCCAACAGGAGC No data
Right 984512988 4:180701603-180701625 TGGGGTCCACCCCTCACAGTGGG No data
984512979_984512988 11 Left 984512979 4:180701569-180701591 CCCAACAGGAGCAAACTCCATTC No data
Right 984512988 4:180701603-180701625 TGGGGTCCACCCCTCACAGTGGG No data
984512985_984512988 -6 Left 984512985 4:180701586-180701608 CCATTCACTTGGTCCACTGGGGT No data
Right 984512988 4:180701603-180701625 TGGGGTCCACCCCTCACAGTGGG No data
984512980_984512988 10 Left 984512980 4:180701570-180701592 CCAACAGGAGCAAACTCCATTCA No data
Right 984512988 4:180701603-180701625 TGGGGTCCACCCCTCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984512988 Original CRISPR TGGGGTCCACCCCTCACAGT GGG Intergenic
No off target data available for this crispr