ID: 984523819

View in Genome Browser
Species Human (GRCh38)
Location 4:180832289-180832311
Sequence GGCCCACTAGGTGGCCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984523819_984523825 18 Left 984523819 4:180832289-180832311 CCTGTATGGCCACCTAGTGGGCC No data
Right 984523825 4:180832330-180832352 AGAGCAGGGTTAATACTTGATGG No data
984523819_984523826 21 Left 984523819 4:180832289-180832311 CCTGTATGGCCACCTAGTGGGCC No data
Right 984523826 4:180832333-180832355 GCAGGGTTAATACTTGATGGTGG No data
984523819_984523823 3 Left 984523819 4:180832289-180832311 CCTGTATGGCCACCTAGTGGGCC No data
Right 984523823 4:180832315-180832337 TGTCAGTGACATCTGAGAGCAGG No data
984523819_984523824 4 Left 984523819 4:180832289-180832311 CCTGTATGGCCACCTAGTGGGCC No data
Right 984523824 4:180832316-180832338 GTCAGTGACATCTGAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984523819 Original CRISPR GGCCCACTAGGTGGCCATAC AGG (reversed) Intergenic
No off target data available for this crispr