ID: 984526631

View in Genome Browser
Species Human (GRCh38)
Location 4:180866243-180866265
Sequence CAGAGTGGCAAGGGGGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984526621_984526631 4 Left 984526621 4:180866216-180866238 CCGTTCTTCTCTCCTTCTTGTCA No data
Right 984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG No data
984526622_984526631 -8 Left 984526622 4:180866228-180866250 CCTTCTTGTCACCTGCAGAGTGG No data
Right 984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984526631 Original CRISPR CAGAGTGGCAAGGGGGTGGC GGG Intergenic
No off target data available for this crispr