ID: 984526967

View in Genome Browser
Species Human (GRCh38)
Location 4:180868705-180868727
Sequence GTGGACCATCGCATTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984526967_984526971 6 Left 984526967 4:180868705-180868727 CCTTCTTCAATGCGATGGTCCAC No data
Right 984526971 4:180868734-180868756 CTCATATTTATTCTTAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984526967 Original CRISPR GTGGACCATCGCATTGAAGA AGG (reversed) Intergenic
No off target data available for this crispr