ID: 984530466

View in Genome Browser
Species Human (GRCh38)
Location 4:180909624-180909646
Sequence TACCCACAGGTCCCTGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984530466_984530469 19 Left 984530466 4:180909624-180909646 CCTCTTCCAGGGACCTGTGGGTA No data
Right 984530469 4:180909666-180909688 GCAGCTATTTCCTGATCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984530466 Original CRISPR TACCCACAGGTCCCTGGAAG AGG (reversed) Intergenic
No off target data available for this crispr