ID: 984535276

View in Genome Browser
Species Human (GRCh38)
Location 4:180967424-180967446
Sequence CTGGCCCAAATTATGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984535272_984535276 10 Left 984535272 4:180967391-180967413 CCCTTGAGAACATTGGATACTGT No data
Right 984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG No data
984535269_984535276 18 Left 984535269 4:180967383-180967405 CCCTCATGCCCTTGAGAACATTG No data
Right 984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG No data
984535267_984535276 22 Left 984535267 4:180967379-180967401 CCACCCCTCATGCCCTTGAGAAC No data
Right 984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG No data
984535266_984535276 23 Left 984535266 4:180967378-180967400 CCCACCCCTCATGCCCTTGAGAA No data
Right 984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG No data
984535265_984535276 24 Left 984535265 4:180967377-180967399 CCCCACCCCTCATGCCCTTGAGA No data
Right 984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG No data
984535273_984535276 9 Left 984535273 4:180967392-180967414 CCTTGAGAACATTGGATACTGTC No data
Right 984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG No data
984535270_984535276 17 Left 984535270 4:180967384-180967406 CCTCATGCCCTTGAGAACATTGG No data
Right 984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG No data
984535268_984535276 19 Left 984535268 4:180967382-180967404 CCCCTCATGCCCTTGAGAACATT No data
Right 984535276 4:180967424-180967446 CTGGCCCAAATTATGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984535276 Original CRISPR CTGGCCCAAATTATGTTTTG AGG Intergenic
No off target data available for this crispr