ID: 984537398

View in Genome Browser
Species Human (GRCh38)
Location 4:180993939-180993961
Sequence GTTTTGTTCAGTGGGATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984537398_984537402 -9 Left 984537398 4:180993939-180993961 CCCTTGATCCCACTGAACAAAAC No data
Right 984537402 4:180993953-180993975 GAACAAAACATTTCTCATTATGG No data
984537398_984537404 18 Left 984537398 4:180993939-180993961 CCCTTGATCCCACTGAACAAAAC No data
Right 984537404 4:180993980-180994002 TCACTGGACTTAATTTCCTATGG No data
984537398_984537403 2 Left 984537398 4:180993939-180993961 CCCTTGATCCCACTGAACAAAAC No data
Right 984537403 4:180993964-180993986 TTCTCATTATGGTTTATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984537398 Original CRISPR GTTTTGTTCAGTGGGATCAA GGG (reversed) Intergenic
No off target data available for this crispr