ID: 984541188

View in Genome Browser
Species Human (GRCh38)
Location 4:181039621-181039643
Sequence CAGGGGGTGGGGAGGGATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984541188_984541202 24 Left 984541188 4:181039621-181039643 CCCTTATCCCTCCCCACCCCCTG No data
Right 984541202 4:181039668-181039690 GCTTTCATCCTCCTGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984541188 Original CRISPR CAGGGGGTGGGGAGGGATAA GGG (reversed) Intergenic
No off target data available for this crispr