ID: 984542694

View in Genome Browser
Species Human (GRCh38)
Location 4:181060358-181060380
Sequence CAGAGGGAAGAAAAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984542694_984542701 -7 Left 984542694 4:181060358-181060380 CCCCCATCCTTTTCTTCCCTCTG No data
Right 984542701 4:181060374-181060396 CCCTCTGGCTTATCTAAATCAGG No data
984542694_984542703 -6 Left 984542694 4:181060358-181060380 CCCCCATCCTTTTCTTCCCTCTG No data
Right 984542703 4:181060375-181060397 CCTCTGGCTTATCTAAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984542694 Original CRISPR CAGAGGGAAGAAAAGGATGG GGG (reversed) Intergenic
No off target data available for this crispr