ID: 984548279

View in Genome Browser
Species Human (GRCh38)
Location 4:181132255-181132277
Sequence ATACACCCGTTTCCAAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984548273_984548279 14 Left 984548273 4:181132218-181132240 CCTAAAATCGTACTCACAGGCAT No data
Right 984548279 4:181132255-181132277 ATACACCCGTTTCCAAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984548279 Original CRISPR ATACACCCGTTTCCAAGGAG GGG Intergenic
No off target data available for this crispr