ID: 984548828

View in Genome Browser
Species Human (GRCh38)
Location 4:181136949-181136971
Sequence TACTGACGACCTTTACCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984548828_984548832 18 Left 984548828 4:181136949-181136971 CCTAATGGTAAAGGTCGTCAGTA No data
Right 984548832 4:181136990-181137012 TTCACATGGAAACACGACCACGG No data
984548828_984548833 24 Left 984548828 4:181136949-181136971 CCTAATGGTAAAGGTCGTCAGTA No data
Right 984548833 4:181136996-181137018 TGGAAACACGACCACGGAAGTGG No data
984548828_984548831 4 Left 984548828 4:181136949-181136971 CCTAATGGTAAAGGTCGTCAGTA No data
Right 984548831 4:181136976-181136998 TGACTGTAACTTATTTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984548828 Original CRISPR TACTGACGACCTTTACCATT AGG (reversed) Intergenic
No off target data available for this crispr