ID: 984551858

View in Genome Browser
Species Human (GRCh38)
Location 4:181170407-181170429
Sequence AATAGGAAGCAGCATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984551855_984551858 0 Left 984551855 4:181170384-181170406 CCTCTTACAGTTGGAGTTTGAAG No data
Right 984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG No data
984551854_984551858 1 Left 984551854 4:181170383-181170405 CCCTCTTACAGTTGGAGTTTGAA No data
Right 984551858 4:181170407-181170429 AATAGGAAGCAGCATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984551858 Original CRISPR AATAGGAAGCAGCATGTGGA AGG Intergenic
No off target data available for this crispr