ID: 984553044 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:181183207-181183229 |
| Sequence | AAGAGTGGCTTGCGCATAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984553044_984553046 | 0 | Left | 984553044 | 4:181183207-181183229 | CCTTCTATGCGCAAGCCACTCTT | No data | ||
| Right | 984553046 | 4:181183230-181183252 | TCATTCATTTTTCATCCTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984553044 | Original CRISPR | AAGAGTGGCTTGCGCATAGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||