ID: 984553046

View in Genome Browser
Species Human (GRCh38)
Location 4:181183230-181183252
Sequence TCATTCATTTTTCATCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984553044_984553046 0 Left 984553044 4:181183207-181183229 CCTTCTATGCGCAAGCCACTCTT No data
Right 984553046 4:181183230-181183252 TCATTCATTTTTCATCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984553046 Original CRISPR TCATTCATTTTTCATCCTCT TGG Intergenic
No off target data available for this crispr