ID: 984554790

View in Genome Browser
Species Human (GRCh38)
Location 4:181200875-181200897
Sequence CAGGATAATAAGATGCAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984554790_984554795 2 Left 984554790 4:181200875-181200897 CCCGATTGCATCTTATTATCCTG No data
Right 984554795 4:181200900-181200922 TTGATTCATGTGGACATTCCTGG No data
984554790_984554793 -8 Left 984554790 4:181200875-181200897 CCCGATTGCATCTTATTATCCTG No data
Right 984554793 4:181200890-181200912 TTATCCTGGTTTGATTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984554790 Original CRISPR CAGGATAATAAGATGCAATC GGG (reversed) Intergenic
No off target data available for this crispr