ID: 984561798

View in Genome Browser
Species Human (GRCh38)
Location 4:181279890-181279912
Sequence GTGGGGTCCCAGAAAGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984561794_984561798 27 Left 984561794 4:181279840-181279862 CCTGTCTGTCATAAACAGGATAC No data
Right 984561798 4:181279890-181279912 GTGGGGTCCCAGAAAGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984561798 Original CRISPR GTGGGGTCCCAGAAAGATTA AGG Intergenic
No off target data available for this crispr