ID: 984561798 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:181279890-181279912 |
| Sequence | GTGGGGTCCCAGAAAGATTA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984561794_984561798 | 27 | Left | 984561794 | 4:181279840-181279862 | CCTGTCTGTCATAAACAGGATAC | No data | ||
| Right | 984561798 | 4:181279890-181279912 | GTGGGGTCCCAGAAAGATTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984561798 | Original CRISPR | GTGGGGTCCCAGAAAGATTA AGG | Intergenic | ||
| No off target data available for this crispr | |||||