ID: 984574943

View in Genome Browser
Species Human (GRCh38)
Location 4:181437285-181437307
Sequence TGAAGCAATTAGAGATTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984574941_984574943 -9 Left 984574941 4:181437271-181437293 CCTGACACAATCTTTGAAGCAAT No data
Right 984574943 4:181437285-181437307 TGAAGCAATTAGAGATTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984574943 Original CRISPR TGAAGCAATTAGAGATTTCT GGG Intergenic
No off target data available for this crispr