ID: 984575098

View in Genome Browser
Species Human (GRCh38)
Location 4:181438672-181438694
Sequence ACCAGCTCACAATGGATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575098_984575103 4 Left 984575098 4:181438672-181438694 CCCAGGATCCATTGTGAGCTGGT No data
Right 984575103 4:181438699-181438721 TAAGGCTCATGAAAGCTGCCTGG No data
984575098_984575107 17 Left 984575098 4:181438672-181438694 CCCAGGATCCATTGTGAGCTGGT No data
Right 984575107 4:181438712-181438734 AGCTGCCTGGGACAGATGGAGGG No data
984575098_984575104 5 Left 984575098 4:181438672-181438694 CCCAGGATCCATTGTGAGCTGGT No data
Right 984575104 4:181438700-181438722 AAGGCTCATGAAAGCTGCCTGGG No data
984575098_984575106 16 Left 984575098 4:181438672-181438694 CCCAGGATCCATTGTGAGCTGGT No data
Right 984575106 4:181438711-181438733 AAGCTGCCTGGGACAGATGGAGG No data
984575098_984575108 18 Left 984575098 4:181438672-181438694 CCCAGGATCCATTGTGAGCTGGT No data
Right 984575108 4:181438713-181438735 GCTGCCTGGGACAGATGGAGGGG No data
984575098_984575105 13 Left 984575098 4:181438672-181438694 CCCAGGATCCATTGTGAGCTGGT No data
Right 984575105 4:181438708-181438730 TGAAAGCTGCCTGGGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575098 Original CRISPR ACCAGCTCACAATGGATCCT GGG (reversed) Intergenic
No off target data available for this crispr