ID: 984575100

View in Genome Browser
Species Human (GRCh38)
Location 4:181438680-181438702
Sequence CTTAGGAAACCAGCTCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575100_984575105 5 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575105 4:181438708-181438730 TGAAAGCTGCCTGGGACAGATGG No data
984575100_984575108 10 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575108 4:181438713-181438735 GCTGCCTGGGACAGATGGAGGGG No data
984575100_984575107 9 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575107 4:181438712-181438734 AGCTGCCTGGGACAGATGGAGGG No data
984575100_984575104 -3 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575104 4:181438700-181438722 AAGGCTCATGAAAGCTGCCTGGG No data
984575100_984575103 -4 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575103 4:181438699-181438721 TAAGGCTCATGAAAGCTGCCTGG No data
984575100_984575111 30 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575111 4:181438733-181438755 GGGCCGTTTTATATATCTTAGGG No data
984575100_984575110 29 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575110 4:181438732-181438754 GGGGCCGTTTTATATATCTTAGG No data
984575100_984575106 8 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575106 4:181438711-181438733 AAGCTGCCTGGGACAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575100 Original CRISPR CTTAGGAAACCAGCTCACAA TGG (reversed) Intergenic
No off target data available for this crispr