ID: 984575102

View in Genome Browser
Species Human (GRCh38)
Location 4:181438697-181438719
Sequence AGGCAGCTTTCATGAGCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575102_984575106 -9 Left 984575102 4:181438697-181438719 CCTAAGGCTCATGAAAGCTGCCT No data
Right 984575106 4:181438711-181438733 AAGCTGCCTGGGACAGATGGAGG No data
984575102_984575111 13 Left 984575102 4:181438697-181438719 CCTAAGGCTCATGAAAGCTGCCT No data
Right 984575111 4:181438733-181438755 GGGCCGTTTTATATATCTTAGGG No data
984575102_984575114 18 Left 984575102 4:181438697-181438719 CCTAAGGCTCATGAAAGCTGCCT No data
Right 984575114 4:181438738-181438760 GTTTTATATATCTTAGGGGCTGG No data
984575102_984575107 -8 Left 984575102 4:181438697-181438719 CCTAAGGCTCATGAAAGCTGCCT No data
Right 984575107 4:181438712-181438734 AGCTGCCTGGGACAGATGGAGGG No data
984575102_984575112 14 Left 984575102 4:181438697-181438719 CCTAAGGCTCATGAAAGCTGCCT No data
Right 984575112 4:181438734-181438756 GGCCGTTTTATATATCTTAGGGG No data
984575102_984575110 12 Left 984575102 4:181438697-181438719 CCTAAGGCTCATGAAAGCTGCCT No data
Right 984575110 4:181438732-181438754 GGGGCCGTTTTATATATCTTAGG No data
984575102_984575108 -7 Left 984575102 4:181438697-181438719 CCTAAGGCTCATGAAAGCTGCCT No data
Right 984575108 4:181438713-181438735 GCTGCCTGGGACAGATGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575102 Original CRISPR AGGCAGCTTTCATGAGCCTT AGG (reversed) Intergenic