ID: 984575105

View in Genome Browser
Species Human (GRCh38)
Location 4:181438708-181438730
Sequence TGAAAGCTGCCTGGGACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575099_984575105 12 Left 984575099 4:181438673-181438695 CCAGGATCCATTGTGAGCTGGTT No data
Right 984575105 4:181438708-181438730 TGAAAGCTGCCTGGGACAGATGG No data
984575098_984575105 13 Left 984575098 4:181438672-181438694 CCCAGGATCCATTGTGAGCTGGT No data
Right 984575105 4:181438708-181438730 TGAAAGCTGCCTGGGACAGATGG No data
984575100_984575105 5 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575105 4:181438708-181438730 TGAAAGCTGCCTGGGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575105 Original CRISPR TGAAAGCTGCCTGGGACAGA TGG Intergenic
No off target data available for this crispr