ID: 984575108

View in Genome Browser
Species Human (GRCh38)
Location 4:181438713-181438735
Sequence GCTGCCTGGGACAGATGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575098_984575108 18 Left 984575098 4:181438672-181438694 CCCAGGATCCATTGTGAGCTGGT No data
Right 984575108 4:181438713-181438735 GCTGCCTGGGACAGATGGAGGGG No data
984575099_984575108 17 Left 984575099 4:181438673-181438695 CCAGGATCCATTGTGAGCTGGTT No data
Right 984575108 4:181438713-181438735 GCTGCCTGGGACAGATGGAGGGG No data
984575100_984575108 10 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575108 4:181438713-181438735 GCTGCCTGGGACAGATGGAGGGG No data
984575102_984575108 -7 Left 984575102 4:181438697-181438719 CCTAAGGCTCATGAAAGCTGCCT No data
Right 984575108 4:181438713-181438735 GCTGCCTGGGACAGATGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575108 Original CRISPR GCTGCCTGGGACAGATGGAG GGG Intergenic
No off target data available for this crispr