ID: 984575109

View in Genome Browser
Species Human (GRCh38)
Location 4:181438717-181438739
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575109_984575116 14 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575116 4:181438754-181438776 GGGCTGGCCACATGACTCACGGG No data
984575109_984575110 -8 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575110 4:181438732-181438754 GGGGCCGTTTTATATATCTTAGG No data
984575109_984575119 27 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575119 4:181438767-181438789 GACTCACGGGGAAAGCCTTGAGG No data
984575109_984575114 -2 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575114 4:181438738-181438760 GTTTTATATATCTTAGGGGCTGG No data
984575109_984575115 13 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575115 4:181438753-181438775 GGGGCTGGCCACATGACTCACGG No data
984575109_984575111 -7 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575111 4:181438733-181438755 GGGCCGTTTTATATATCTTAGGG No data
984575109_984575112 -6 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575112 4:181438734-181438756 GGCCGTTTTATATATCTTAGGGG No data
984575109_984575117 15 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575117 4:181438755-181438777 GGCTGGCCACATGACTCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575109 Original CRISPR ACGGCCCCTCCATCTGTCCC AGG (reversed) Intergenic