ID: 984575111

View in Genome Browser
Species Human (GRCh38)
Location 4:181438733-181438755
Sequence GGGCCGTTTTATATATCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575102_984575111 13 Left 984575102 4:181438697-181438719 CCTAAGGCTCATGAAAGCTGCCT No data
Right 984575111 4:181438733-181438755 GGGCCGTTTTATATATCTTAGGG No data
984575100_984575111 30 Left 984575100 4:181438680-181438702 CCATTGTGAGCTGGTTTCCTAAG No data
Right 984575111 4:181438733-181438755 GGGCCGTTTTATATATCTTAGGG No data
984575109_984575111 -7 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575111 4:181438733-181438755 GGGCCGTTTTATATATCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575111 Original CRISPR GGGCCGTTTTATATATCTTA GGG Intergenic
No off target data available for this crispr