ID: 984575112

View in Genome Browser
Species Human (GRCh38)
Location 4:181438734-181438756
Sequence GGCCGTTTTATATATCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575102_984575112 14 Left 984575102 4:181438697-181438719 CCTAAGGCTCATGAAAGCTGCCT No data
Right 984575112 4:181438734-181438756 GGCCGTTTTATATATCTTAGGGG No data
984575109_984575112 -6 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575112 4:181438734-181438756 GGCCGTTTTATATATCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575112 Original CRISPR GGCCGTTTTATATATCTTAG GGG Intergenic
No off target data available for this crispr