ID: 984575113

View in Genome Browser
Species Human (GRCh38)
Location 4:181438736-181438758
Sequence AGCCCCTAAGATATATAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575113_984575123 26 Left 984575113 4:181438736-181438758 CCGTTTTATATATCTTAGGGGCT No data
Right 984575123 4:181438785-181438807 TGAGGACATTCTGCTCCTTGGGG No data
984575113_984575122 25 Left 984575113 4:181438736-181438758 CCGTTTTATATATCTTAGGGGCT No data
Right 984575122 4:181438784-181438806 TTGAGGACATTCTGCTCCTTGGG No data
984575113_984575116 -5 Left 984575113 4:181438736-181438758 CCGTTTTATATATCTTAGGGGCT No data
Right 984575116 4:181438754-181438776 GGGCTGGCCACATGACTCACGGG No data
984575113_984575115 -6 Left 984575113 4:181438736-181438758 CCGTTTTATATATCTTAGGGGCT No data
Right 984575115 4:181438753-181438775 GGGGCTGGCCACATGACTCACGG No data
984575113_984575117 -4 Left 984575113 4:181438736-181438758 CCGTTTTATATATCTTAGGGGCT No data
Right 984575117 4:181438755-181438777 GGCTGGCCACATGACTCACGGGG No data
984575113_984575121 24 Left 984575113 4:181438736-181438758 CCGTTTTATATATCTTAGGGGCT No data
Right 984575121 4:181438783-181438805 CTTGAGGACATTCTGCTCCTTGG No data
984575113_984575119 8 Left 984575113 4:181438736-181438758 CCGTTTTATATATCTTAGGGGCT No data
Right 984575119 4:181438767-181438789 GACTCACGGGGAAAGCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575113 Original CRISPR AGCCCCTAAGATATATAAAA CGG (reversed) Intergenic
No off target data available for this crispr