ID: 984575114 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:181438738-181438760 |
| Sequence | GTTTTATATATCTTAGGGGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984575102_984575114 | 18 | Left | 984575102 | 4:181438697-181438719 | CCTAAGGCTCATGAAAGCTGCCT | No data | ||
| Right | 984575114 | 4:181438738-181438760 | GTTTTATATATCTTAGGGGCTGG | No data | ||||
| 984575109_984575114 | -2 | Left | 984575109 | 4:181438717-181438739 | CCTGGGACAGATGGAGGGGCCGT | No data | ||
| Right | 984575114 | 4:181438738-181438760 | GTTTTATATATCTTAGGGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984575114 | Original CRISPR | GTTTTATATATCTTAGGGGC TGG | Intergenic | ||