ID: 984575116

View in Genome Browser
Species Human (GRCh38)
Location 4:181438754-181438776
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575113_984575116 -5 Left 984575113 4:181438736-181438758 CCGTTTTATATATCTTAGGGGCT No data
Right 984575116 4:181438754-181438776 GGGCTGGCCACATGACTCACGGG No data
984575109_984575116 14 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575116 4:181438754-181438776 GGGCTGGCCACATGACTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type