ID: 984575117

View in Genome Browser
Species Human (GRCh38)
Location 4:181438755-181438777
Sequence GGCTGGCCACATGACTCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575109_984575117 15 Left 984575109 4:181438717-181438739 CCTGGGACAGATGGAGGGGCCGT No data
Right 984575117 4:181438755-181438777 GGCTGGCCACATGACTCACGGGG No data
984575113_984575117 -4 Left 984575113 4:181438736-181438758 CCGTTTTATATATCTTAGGGGCT No data
Right 984575117 4:181438755-181438777 GGCTGGCCACATGACTCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575117 Original CRISPR GGCTGGCCACATGACTCACG GGG Intergenic
No off target data available for this crispr