ID: 984575123

View in Genome Browser
Species Human (GRCh38)
Location 4:181438785-181438807
Sequence TGAGGACATTCTGCTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575113_984575123 26 Left 984575113 4:181438736-181438758 CCGTTTTATATATCTTAGGGGCT No data
Right 984575123 4:181438785-181438807 TGAGGACATTCTGCTCCTTGGGG No data
984575118_984575123 1 Left 984575118 4:181438761-181438783 CCACATGACTCACGGGGAAAGCC No data
Right 984575123 4:181438785-181438807 TGAGGACATTCTGCTCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575123 Original CRISPR TGAGGACATTCTGCTCCTTG GGG Intergenic
No off target data available for this crispr