ID: 984575123 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:181438785-181438807 |
Sequence | TGAGGACATTCTGCTCCTTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
984575113_984575123 | 26 | Left | 984575113 | 4:181438736-181438758 | CCGTTTTATATATCTTAGGGGCT | No data | ||
Right | 984575123 | 4:181438785-181438807 | TGAGGACATTCTGCTCCTTGGGG | No data | ||||
984575118_984575123 | 1 | Left | 984575118 | 4:181438761-181438783 | CCACATGACTCACGGGGAAAGCC | No data | ||
Right | 984575123 | 4:181438785-181438807 | TGAGGACATTCTGCTCCTTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
984575123 | Original CRISPR | TGAGGACATTCTGCTCCTTG GGG | Intergenic | ||