ID: 984575576

View in Genome Browser
Species Human (GRCh38)
Location 4:181444202-181444224
Sequence CCTTCCAGGAACACACTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984575568_984575576 17 Left 984575568 4:181444162-181444184 CCAAATATCTCATTTCCACAGTC No data
Right 984575576 4:181444202-181444224 CCTTCCAGGAACACACTGGTTGG No data
984575567_984575576 18 Left 984575567 4:181444161-181444183 CCCAAATATCTCATTTCCACAGT No data
Right 984575576 4:181444202-181444224 CCTTCCAGGAACACACTGGTTGG No data
984575572_984575576 2 Left 984575572 4:181444177-181444199 CCACAGTCACTCTATGGGCAGGA No data
Right 984575576 4:181444202-181444224 CCTTCCAGGAACACACTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984575576 Original CRISPR CCTTCCAGGAACACACTGGT TGG Intergenic
No off target data available for this crispr