ID: 984576449

View in Genome Browser
Species Human (GRCh38)
Location 4:181453813-181453835
Sequence GAACTCCCCTTGGCCAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984576444_984576449 20 Left 984576444 4:181453770-181453792 CCTGTAGGGATGCCTGAATTTTT No data
Right 984576449 4:181453813-181453835 GAACTCCCCTTGGCCAGCACAGG No data
984576445_984576449 8 Left 984576445 4:181453782-181453804 CCTGAATTTTTTATGACAGTCAG No data
Right 984576449 4:181453813-181453835 GAACTCCCCTTGGCCAGCACAGG No data
984576443_984576449 28 Left 984576443 4:181453762-181453784 CCGTTAGTCCTGTAGGGATGCCT No data
Right 984576449 4:181453813-181453835 GAACTCCCCTTGGCCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984576449 Original CRISPR GAACTCCCCTTGGCCAGCAC AGG Intergenic
No off target data available for this crispr