ID: 984579031

View in Genome Browser
Species Human (GRCh38)
Location 4:181488387-181488409
Sequence ACAGAGATGAGAAATCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984579031_984579038 1 Left 984579031 4:181488387-181488409 CCCTCCTGATTTCTCATCTCTGT No data
Right 984579038 4:181488411-181488433 GGGATTTGAAACAAACCACAGGG No data
984579031_984579037 0 Left 984579031 4:181488387-181488409 CCCTCCTGATTTCTCATCTCTGT No data
Right 984579037 4:181488410-181488432 GGGGATTTGAAACAAACCACAGG No data
984579031_984579040 23 Left 984579031 4:181488387-181488409 CCCTCCTGATTTCTCATCTCTGT No data
Right 984579040 4:181488433-181488455 GTGAACATCACCTCTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984579031 Original CRISPR ACAGAGATGAGAAATCAGGA GGG (reversed) Intergenic
No off target data available for this crispr