ID: 984579037

View in Genome Browser
Species Human (GRCh38)
Location 4:181488410-181488432
Sequence GGGGATTTGAAACAAACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984579030_984579037 16 Left 984579030 4:181488371-181488393 CCTTTCTTATCTCTGACCCTCCT No data
Right 984579037 4:181488410-181488432 GGGGATTTGAAACAAACCACAGG No data
984579035_984579037 -4 Left 984579035 4:181488391-181488413 CCTGATTTCTCATCTCTGTGGGG No data
Right 984579037 4:181488410-181488432 GGGGATTTGAAACAAACCACAGG No data
984579032_984579037 -1 Left 984579032 4:181488388-181488410 CCTCCTGATTTCTCATCTCTGTG No data
Right 984579037 4:181488410-181488432 GGGGATTTGAAACAAACCACAGG No data
984579031_984579037 0 Left 984579031 4:181488387-181488409 CCCTCCTGATTTCTCATCTCTGT No data
Right 984579037 4:181488410-181488432 GGGGATTTGAAACAAACCACAGG No data
984579029_984579037 21 Left 984579029 4:181488366-181488388 CCAAGCCTTTCTTATCTCTGACC No data
Right 984579037 4:181488410-181488432 GGGGATTTGAAACAAACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984579037 Original CRISPR GGGGATTTGAAACAAACCAC AGG Intergenic
No off target data available for this crispr